Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU082221

Sigma-Aldrich

MISSION® esiRNA

targeting human SIN3A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAGAGAGAGAATGGGAACGGGAAGTGCTGGGCATAAAGCGAGACAAGAGTGACAGCCCTGCCATTCAGCTACGTCTCAAAGAACCTATGGATGTTGATGTAGAAGATTATTACCCAGCTTTCCTGGACATGGTGCGGAGCCTGCTGGATGGCAACATAGACTCATCACAGTATGAAGATTCACTGAGAGAGATGTTCACCATTCATGCCTACATTGCCTTTACCATGGACAAACTGATCCAGAGCATTGTCAGACAGCTGCAGCATATCGTGAGTGATGAGATCTGTGTGCAGGTGACTGACCTTTACCTGGCAGAAAATAATAATGGGGCCACCGGAGGCCAGCTGAACACACAGAACTCAAGGAGCCTCCTGGAGTCAACGTATCAGCGGAAAGCTGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jie Ren et al.
Experimental and therapeutic medicine, 18(4), 2565-2573 (2019-09-27)
Previous studies have indicated that microRNA (miR)-210-3p is upregulated in NSCLC, however, the specific mechanism underlying the role of miR-210-3p in NSCLC pathogenesis requires further investigation. The aim of the present study was to explore the roles of miR-210-3p in
Giovanni Gambi et al.
Cancer research, 79(12), 3076-3087 (2019-01-30)
Epigenetic silencing of promoter and enhancer regions is a common phenomenon in malignant cells. The transcription factor STAT3 is aberrantly activated in several tumors, where its constitutive acetylation accounts for the transcriptional repression of a number of tumor suppressor genes
Sweta Srivas et al.
Journal of neurochemistry, 145(3), 204-216 (2018-03-02)
Epigenetic modifications through methylation of DNA and acetylation of histones modulate neuronal gene expression and regulate long-term memory. Earlier we demonstrated that scopolamine-induced decrease in memory consolidation is correlated with enhanced expression of hippocampal DNA methyltransferase 1 (DNMT1) and histone

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service