Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU078571

Sigma-Aldrich

MISSION® esiRNA

targeting human CYLD

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCCTCCTCCTGTGAACTCACTGACCACCGAGAACAGATTCCACTCTTTACCATTCAGTCTCACCAAGATGCCCAATACCAATGGAAGTATTGGCCACAGTCCACTTTCTCTGTCAGCCCAGTCTGTAATGGAAGAGCTAAACACTGCACCCGTCCAAGAGAGTCCACCCTTGGCCATGCCTCCTGGGAACTCACATGGTCTAGAAGTGGGCTCATTGGCTGAAGTTAAGGAGAACCCTCCTTTCTATGGGGTAATCCGTTGGATCGGTCAGCCACCAGGACTGAATGAAGTGCTCGCTGGACTGGAACTGGAAGATGAGTGTGCAGGCTGTACGGATGGAACCTTCAGAGGCACTCGGTATTTCACCTGTGCCCTGAAGAAGGCGCTGTTTGTGAAACTGAAGAGCTGCAGGCCTGACTCTAGGTTTGCATCATTGCAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tadaatsu Imaizumi et al.
Kidney & blood pressure research, 42(5), 942-950 (2017-11-23)
Cylindromatosis (CYLD), a deubiquitinase, negatively regulates nuclear factor-κB in various cells. However, its potential roles in glomerular inflammation remain unclear. Because the activation of the Toll-like receptor 3 (TLR3)/type I interferon (IFN) pathways plays a pivotal role in chronic kidney
Suruchi N Schock et al.
Cell death and differentiation, 24(4), 615-625 (2017-01-07)
Necroptosis is a form of necrotic cell death that requires the activity of the death domain-containing kinase RIP1 and its family member RIP3. Necroptosis occurs when RIP1 is deubiquitinated to form a complex with RIP3 in cells deficient in the
Yuki Imaizumi et al.
Biochemical and biophysical research communications, 508(4), 1168-1174 (2018-12-18)
Cardiovascular disease is one of the leading causes of death in the elderly, and novel therapeutic targets against atherogenesis are urgent. The initiation of atherosclerotic changes of monocyte adhesion on the vascular endothelium and subsequent foam cell formation are noteworthy
Ming Zhao et al.
Cancer medicine, 9(3), 1196-1208 (2019-12-21)
According to the global cancer statistic, lung cancer is one of the most dangerous tumors, which poses a serious threat to human health. Exploration the mechanism of lung cancer and new targeted therapeutic measures is always the hot topic. Long
Kensei Komatsu et al.
Journal of immunology (Baltimore, Md. : 1950), 204(4), 933-942 (2020-01-05)
Otitis media (OM) is the most common bacterial infection in children. It remains a major health problem and a substantial socioeconomic burden. Streptococcus pneumoniae (S. pneumoniae) is one of the most common bacterial pathogens causing OM. Innate inflammatory response plays

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service