Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU078541

Sigma-Aldrich

MISSION® esiRNA

targeting human GLS2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTGGACAAGCTGGGGAACAGCCATAGGGGGACCAGCTTCTGCCAGAAGTTGGTGTCTCTCTTCAATTTCCACAACTATGACAACCTGAGGCACTGTGCTCGGAAGTTAGACCCACGGCGTGAAGGGGCAGAAATTCGGAACAAGACTGTGGTCAACCTGTTATTTGCTGCCTATAGTGGCGATGTCTCAGCTCTTCGAAGGTTTGCCTTGTCAGCCATGGATATGGAACAGAAAGACTATGACTCGCGCACAGCTCTGCATGTTGCTGCAGCTGAAGGACACATCGAAGTTGTTAAATTCCTGATCGAGGCTTGCAAAGTGAATCCTTTTGCCAAGGACAGGTGGGGCAACATTCCCCTGGATGATGCTGTGCAGTTCAACCATCTGGAGGTGGTCAAACTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xulu Ye et al.
Anticancer research, 36(11), 6021-6029 (2016-10-30)
Inhibition of glutaminolysis has been reported as a promising therapeutic strategy to target several solid carcinomas. We aimed to investigate the effects of glutaminolysis on cell proliferation in lung squamous cell carcinoma cell lines and to explore the potential of
Ying Niu et al.
Life sciences, 237, 116893-116893 (2019-10-14)
Gastric cancer (GC) is a common human malignancy tumor of digestive tract in worldwide. Physcion 8-O-β-glucopyranoside (PG) exhibits anti-tumor effects in various cancer cells. This study aimed to explore the biological behavior effects of PG on GC cells, and determine
Jason D Arroyo et al.
Nucleic acids research, 42(9), 6064-6077 (2014-03-07)
Unlike short interfering RNAs (siRNAs), which are commonly designed to repress a single messenger RNA (mRNA) target through perfect base pairing, microRNAs (miRNAs) are endogenous small RNAs that have evolved to concurrently repress multiple mRNA targets through imperfect complementarity. MicroRNA

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service