Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU073271

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGTACCCACTGGAAGGACTTAGGCGCTCGCGTGGACACCGCAAGCCCCTCAGTAGCCTCGGCCCAAGAGGCCTGCTTTCCACTCGCTAGCCCCGCCGGGGGTCCGTGTCCTGTCTCGGTGGCCGGACCCGGGCCCGAGCCCGAGCAGTAGCCGGCGCCATGTCGGTGGTGGGCATAGACCTGGGCTTCCAGAGCTGCTACGTCGCTGTGGCCCGCGCCGGCGGCATCGAGACTATCGCTAATGAGTATAGCGACCGCTGCACGCCGGCTTGCATTTCTTTTGGTCCTAAGAATCGTTCAATTGGAGCAGCAGCTAAAAGCCAGGTAATTTCTAATGCAAAGAACACAGTCCAAGGATTTAAAAGATTCCATGGCCGAGCATTCTCTGATCCATTTGTGGAGGCAGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dmitry Kondrikov et al.
PloS one, 10(6), e0129343-e0129343 (2015-06-13)
Exposure of pulmonary artery endothelial cells (PAECs) to hyperoxia results in a compromise in endothelial monolayer integrity, an increase in caspase-3 activity, and nuclear translocation of apoptosis-inducing factor (AIF), a marker of caspase-independent apoptosis. In an endeavor to identify proteins
Alessandro Vanoli et al.
Histochemistry and cell biology, 144(2), 179-184 (2015-05-09)
Ubiquitin-proteasome system (UPS) proteins and proteolytic activity are localized in a recently identified cytoplasmic structure characterized by accumulation of barrel-like particles, which is known as the particulate cytoplasmic structure (PaCS). PaCSs have been detected in neoplastic, preneoplastic, chronically infected, and
Sujatha Muralidharan et al.
Journal of immunology (Baltimore, Md. : 1950), 193(4), 1975-1987 (2014-07-16)
Binge or moderate alcohol exposure impairs host defense and increases susceptibility to infection because of compromised innate immune responses. However, there is a lack of consensus on the molecular mechanism by which alcohol mediates this immunosuppression. In this study, we

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service