Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU070021

Sigma-Aldrich

MISSION® esiRNA

targeting human TFAP2A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTCCAAGTCCAACAGCAATGCCGTCTCCGCCATCCCTATTAACAAGGACAACCTCTTCGGCGGCGTGGTGAACCCCAACGAAGTCTTCTGTTCAGTTCCGGGTCGCCTCTCGCTCCTCAGCTCCACCTCGAAGTACAAGGTCACGGTGGCGGAAGTGCAGCGGCGGCTCTCACCACCCGAGTGTCTCAACGCGTCGCTGCTGGGCGGAGTGCTCCGGAGGGCGAAGTCTAAAAATGGAGGAAGATCTTTAAGAGAAAAACTGGACAAAATAGGATTAAATCTGCCTGCAGGGAGACGTAAAGCTGCCAACGTTACCCTGCTCACATCACTAGTAGAGGGAGAAGCTGTCCACCTAGCCAGGGACTTTGGGTACGTGTGCGAAACCGAATTTCCTGCCAAAGCAGTAGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fuchao Zhang et al.
Neurochemical research, 44(12), 2776-2785 (2019-10-28)
Transcription factors regulate the transcriptions and expressions of numerous target genes and direct a variety of physiological and pathological activities. To obtain a better understanding of the involvement of transcription factors during peripheral nerve repair and regeneration, significantly differentially expressed
Liesbeth Minnoye et al.
Genome research, 30(12), 1815-1834 (2020-08-01)
Deciphering the genomic regulatory code of enhancers is a key challenge in biology because this code underlies cellular identity. A better understanding of how enhancers work will improve the interpretation of noncoding genome variation and empower the generation of cell
Cameron C Scott et al.
eLife, 7 (2018-09-27)
How trafficking pathways and organelle abundance adapt in response to metabolic and physiological changes is still mysterious, although a few transcriptional regulators of organellar biogenesis have been identified in recent years. We previously found that the Wnt signaling directly controls

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service