Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU067311

Sigma-Aldrich

MISSION® esiRNA

targeting human NFKB2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAAGAGGCCAAAGAACTGAAGAAGGTGATGGATCTGAGTATAGTGCGGCTGCGCTTCTCTGCCTTCCTTAGAGCCAGTGATGGCTCCTTCTCCCTGCCCCTGAAGCCAGTCATCTCCCAGCCCATCCATGACAGCAAATCTCCGGGGGCATCAAACCTGAAGATTTCTCGAATGGACAAGACAGCAGGCTCTGTGCGGGGTGGAGATGAAGTTTATCTGCTTTGTGACAAGGTGCAGAAAGATGACATTGAGGTTCGGTTCTATGAGGATGATGAGAATGGATGGCAGGCCTTTGGGGACTTCTCTCCCACAGATGTGCATAAACAGTATGCCATTGTGTTCCGGACACCCCCCTATCACAAGATGAAGATTGAGCGGCCTGTAACAGTGTTTCTGCAACTGAAACGCAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jeong Seon Kim et al.
Biochemical and biophysical research communications, 491(2), 337-342 (2017-07-25)
The NFκB family of transcription factors is crucial for innate or adaptive immunity, inflammation, and diseases including cancer. The two NFκB signaling pathways (canonical and non-canonical) differ from each other in extracellular signals, membrane receptors, signaling adaptors, and dimer subunits.
Shayna E Thomas-Jardin et al.
The Prostate, 80(2), 133-145 (2019-11-16)
The androgen receptor (AR) nuclear transcription factor is a therapeutic target for prostate cancer (PCa). Unfortunately, patients can develop resistance to AR-targeted therapies and progress to lethal disease, underscoring the importance of understanding the molecular mechanisms that underlie treatment resistance.
Laura Mondragón et al.
Cancer cell, 36(3), 268-287 (2019-08-27)
GAPDH is emerging as a key player in T cell development and function. To investigate the role of GAPDH in T cells, we generated a transgenic mouse model overexpressing GAPDH in the T cell lineage. Aged mice developed a peripheral Tfh-like lymphoma that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service