Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU061981

Sigma-Aldrich

MISSION® esiRNA

targeting human ADGRE5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTGGATGAACTGATGGAAGCTCCTGGAGACGTAGAGGCCCTGGCGCCACCTGTCCGGCACCTCATAGCCACCCAGCTGCTCTCAAACCTTGAAGATATCATGAGGATCCTGGCCAAGAGCCTGCCTAAAGGCCCCTTCACCTACATTTCCCCTTCGAACACAGAGCTGACCCTGATGATCCAGGAGCGGGGGGACAAGAACGTCACTATGGGTCAGAGCAGCGCACGCATGAAGCTGAATTGGGCTGTGGCAGCTGGAGCCGAGGATCCAGGCCCCGCCGTGGCGGGCATCCTCTCCATCCAGAACATGACGACATTGCTGGCCAATGCCTCCTTGAACCTGCATTCCAAGAAGCAAGCCGAACTGGAGGAGATATATGAAAGCAGCATCCGTGGTGTCCAACTCAGACGCCTCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wolfram Eichler et al.
Annals of the New York Academy of Sciences, 1456(1), 64-79 (2019-08-10)
Cell surface molecules of retinal pigment epithelial (RPE) cells participate in the pathogenesis of retinal diseases. In an attempt to identify cell surface proteins that play a role in RPE cell-cell interactions, we have considered studying the expression, regulation, and
Manja Wobus et al.
Oncotarget, 6(36), 38804-38815 (2015-10-16)
Internal tandem duplications within the juxtamembrane region of the FMS-like tyrosine kinase receptor FLT3 (FLT3-ITD) represents one of the most common mutations in patients with acute myeloid leukemia (AML) which results in constitutive aberrant activation, increased proliferation of leukemic progenitors

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service