Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU060371

Sigma-Aldrich

MISSION® esiRNA

targeting human TTBK2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAGGCACATTCACCATTAGTACCACTCTCCGGCTGGGTAGACAGATTTTGGAGTCTATTGAAAGCATTCATTCTGTGGGATTCTTGCATCGAGACATCAAACCGTCGAACTTCGCTATGGGTCGCTTTCCTAGTACATGTAGGAAATGTTACATGCTTGATTTTGGCTTGGCTCGACAATTTACCAATTCCTGTGGTGACGTCAGACCACCTCGAGCTGTGGCAGGTTTTCGAGGGACAGTTCGTTATGCATCAATCAACGCACATCGGAACAGGGAAATGGGAAGACATGATGACCTTTGGTCCTTATTCTACATGTTGGTGGAGTTTGTGGTTGGTCAGCTGCCCTGGAGAAAAATAAAGGACAAGGAGCAAGTAGGCTCTATTAAGGAGAGATATGACCACAGGCTCATGTTGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xing Liu et al.
Oncotarget, 6(33), 34309-34320 (2015-09-30)
Hepatocellular carcinoma (HCC) is one of the most malignant cancers with poor clinical outcome. The protein kinase human monopolar spindle 1 (hMps1/TTK) gene expression is significantly increased in HCCs. However, its contributions to hepatocarcinogenesis remain unclear. In this study, we
Mi-Young Lee et al.
Cell division, 9, 3-3 (2014-10-04)
Centrosome amplification (CA) amongst particular breast cancer subtypes (Her2+ subtype) is associated with genomic instability and aggressive tumor phenotypes. However, changes in signaling pathways associated with centrosome biology have not been fully explored in subtype specific models. Novel centrosome regulatory
Takashi Watanabe et al.
The Journal of cell biology, 210(5), 737-751 (2015-09-02)
Microtubules (MTs) play critical roles in various cellular events, including cell migration. End-binding proteins (EBs) accumulate at the ends of growing MTs and regulate MT end dynamics by recruiting other plus end-tracking proteins (+TIPs). However, how EBs contribute to MT

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service