Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU046621

Sigma-Aldrich

MISSION® esiRNA

targeting human IL6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCAATAACCACCCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCAGGACATGACAACTCATCTCATTCTGCGCAGCTTTAAGGAGTTCCTGCAGTCCAGCCTGAGGGCTCTTCGGCAAATGTAGCATGGGCACCTCAGATTGTTGTTGTTAATGGGCATTCCTTCTTCTGGTCAGAAACCTGTCCACTGGGCACAGAACTTATGTTGTTCTCTATGGAGAACTAAAAGTATGAGCGTTAGGACACTATTTTAATTATTTTTAATTTATTAATATTTAAATATGTGAAGCTGAGTTAATTTATGTAAGTCATATTTATATTTTTAAGAAGTACCACTTGAAACATTTTATGTATTAGTTTTGAAATAATAATGGAAAGTGGCTATGCAGTTTGAATATCCTTTGTTTCAGAGCCAGATCATTTCTTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Eun-Ah Ye et al.
Vision research, 139, 15-22 (2017-04-24)
microRNA (miRNA) play critical roles in the pathological processes of diabetic retinopathy, including inflammatory responses, insulin signaling, and angiogenesis. In addition to their regulatory functions on gene expression, miRNA is considered as a potential therapeutic target, as well as a
Yaqi Yin et al.
Cell death & disease, 9(7), 760-760 (2018-07-11)
Progressive pancreatic β-cell dysfunction is recognized as a fundamental pathology of type 2 diabetes (T2D). Recently, mesenchymal stem cells (MSCs) have been identified in protection of islets function in T2D individuals. However, the underlying mechanisms remain elusive. It is widely
Shui-Fang Chen et al.
Molecular medicine reports, 16(3), 2733-2739 (2017-06-29)
Resistance to epidermal growth factor receptor (EGFR) inhibitors is of primary concern in the treatment of non‑small‑cell lung cancer (NSCLC) with EGFR mutations. To investigate the effects of matrine on H1975 cells and to examine a novel, potential treatment option for NSCLC
Hu Liu et al.
Biochemical and biophysical research communications, 486(2), 239-244 (2017-03-04)
Limited efficacy of immune checkpoint inhibitors in hepatocellular carcinoma (HCC) was observed in clinical trials, thus prompting investigation into combination therapy. Interleukin-6 (IL-6) has important roles in modeling immune responses in cancers. Here, we hypothesized that IL-6 blockade would enhance
Qiang Fu et al.
Cancer cell international, 17, 79-79 (2017-09-08)
Cisplatin has been used in the treatment of many cancers, including laryngeal cancer; however, its efficacy can be reduced due to the development of drug resistance. This study aimed to investigate whether interleukin-6 (IL-6) knockdown may enhance the efficacy of

Global Trade Item Number

SKUGTIN
EHU046621-50UG4061831371741
EHU046621-20UG4061831342840

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service