Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU029771

Sigma-Aldrich

MISSION® esiRNA

targeting human MYD88

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCAGAGCAAGGAATGTGACTTCCAGACCAAATTTGCACTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCAATGAAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCCTGCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGAAGACTGTTCTGAGGCCCTGGGTGTGTGTGTATCTGTCTGCCTGTCCATGTACTTCTGCCCTGCCTCCTCCTTTCGTTGTAGGAGGAATCTGTGCTCTACTTACCTCTCAATTCCTGGAGATGCCAACTTCACAGACACGTCTGCAGCAGCTGGACATCACATTTCATGTCCTGCATGGAACCAGTGGCTGTGAGTGGCATGTCCACTTGCTGGATTATCAGCCAGGACACTATAGAACAGGACCAGCTGAGACTAAGAAGGACCAGCAGAGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Michele Cea et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 22(24), 6099-6109 (2016-06-12)
Nicotinamide phosphoribosyltransferase (Nampt) regulates intracellular NAD We investigated Nampt role in MW cells using both mRNA and protein expression analyses. We have also used loss-of-function approaches to investigate the growth and survival effects of Nampt on MW cells and further
Lingyu Zhang et al.
Gene, 700, 85-95 (2019-03-18)
MiR-155-3p, which is derived from the same pre-miRNA as miR-155-5p, the latter has been reported to be dysregulated in multiple tumor tissues and associated with clinicopathologic markers, tumor subtypes, and poor survival rates. However, the biological effects of miR-155-3p are
Xin Wen et al.
Journal of cellular physiology, 233(9), 7022-7034 (2018-01-31)
Epilepsy is a group of neurological disorders characterized by epileptic seizures. In this study, we aim to explore the role of microRNA-421 (miR-421) in hippocampal neurons of epilepsy mice via the TLR/MYD88 pathway. Forty mice were randomly served as the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service