Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU009051

Sigma-Aldrich

MISSION® esiRNA

targeting human DDIT4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTACTGCGCCTGGCCTACAGCGAGCCGTGCGGCCTGCGGGGGGCGCTGCTGGACGTCTGCGTGGAGCAGGGCAAGAGCTGCCACAGCGTGGGCCAGCTGGCACTCGACCCCAGCCTGGTGCCCACCTTCCAGCTGACCCTCGTGCTGCGCCTGGACTCACGACTCTGGCCCAAGATCCAGGGGCTGTTTAGCTCCGCCAACTCTCCCTTCCTCCCTGGCTTCAGCCAGTCCCTGACGCTGAGCACTGGCTTCCGAGTCATCAAGAAGAAGCTGTACAGCTCGGAACAGCTGCTCATTGAGGAGTGTTGAACTTCAACCTGAGGGGGCCGACAGTGCCCTCCAAGACAGAGACGACTGAACTTTTGGGGTGGAGACTAGAGGCAGGAGCTGAGGGACTGATTCCTGTGGTTGGAAAACTGAGGCAGCCACCTAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Oscar Alvarez-Garcia et al.
Arthritis & rheumatology (Hoboken, N.J.), 69(7), 1418-1428 (2017-03-24)
Regulated in development and DNA damage response 1 (REDD1) is an endogenous inhibitor of mechanistic target of rapamycin (mTOR) that regulates cellular stress responses. REDD1 expression is decreased in aged and osteoarthritic (OA) cartilage, and it regulates mTOR signaling and
Bowen Wang et al.
Investigative ophthalmology & visual science, 60(8), 2836-2847 (2019-07-03)
To assess how DNA damage-inducible transcript 4 (DDIT4) and autophagic flux are altered in dry eye disease and reveal the underlying mechanisms. C57BL/6 mice were exposed to desiccating stress (subcutaneous scopolamine [0.5 mg/0.2 mL] 3 times a day, humidity <
Alexandra M Stevens et al.
Blood advances, 3(24), 4215-4227 (2019-12-20)
Atovaquone, a US Food and Drug Administration-approved antiparasitic drug previously shown to reduce interleukin-6/STAT3 signaling in myeloma cells, is well tolerated, and plasma concentrations of 40 to 80 µM have been achieved with pediatric and adult dosing. We conducted preclinical
Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service