Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU003851

Sigma-Aldrich

MISSION® esiRNA

targeting human SAMHD1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGCATGAACAAGGCTCAGTTATGATGTTTGAGCACCTTATTAATTCTAATGGAATTAAGCCTGTCATGGAACAATATGGTCTCATCCCTGAAGAAGATATTTGCTTTATAAAGGAACAAATTGTAGGACCACTTGAATCACCTGTCGAAGATTCATTGTGGCCATATAAAGGGCGTCCTGAAAACAAAAGCTTCCTTTATGAGATAGTATCTAATAAAAGAAATGGCATTGATGTGGACAAATGGGATTATTTTGCCAGGGACTGCCATCATCTTGGAATCCAAAATAATTTTGATTACAAGCGCTTTATTAAGTTTGCCCGTGTCTGTGAAGTAGACAATGAGTTGCGTATTTGTGCTAGAGATAAGGAAGTTGGAAATCTGTATGACATGTTCCACACTCGCAACTCTTTACACCGTAGAGCTTATCAACACAAAGTTGGCAACATTATTGATACAATGATTACAGATGCTTTCCTCAAAGCAGATGACTACATAGAGATTACAGGTGCTGGAGGAAAAAAGTATCGCATTTCTACAGCAATTGACGACATGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Weihui Fu et al.
Scientific reports, 6, 38162-38162 (2016-12-07)
SAMHD1 restricts human immunodeficiency virus type 1 (HIV-1) replication in myeloid cells and CD4+ T cells, while Vpx can mediate SAMHD1 degradation to promote HIV-1 replication. Although the restriction mechanisms of SAMHD1 have been well-described, SAMHD1 expression and Vpx-mediated SAMHD1
Thomas Oellerich et al.
Nature communications, 10(1), 3475-3475 (2019-08-04)
Hypomethylating agents decitabine and azacytidine are regarded as interchangeable in the treatment of acute myeloid leukemia (AML). However, their mechanisms of action remain incompletely understood, and predictive biomarkers for HMA efficacy are lacking. Here, we show that the bioactive metabolite
Jiaming Su et al.
Nature microbiology, 4(12), 2552-2564 (2019-10-30)
Innate immunity is the first line of host defence against pathogens. Suppression of innate immune responses is essential for the survival of all viruses. However, the interplay between innate immunity and HIV/SIV is only poorly characterized. We have discovered Vpx
Vera Rocha-Perugini et al.
Nature microbiology, 2(11), 1513-1522 (2017-09-06)
In this study, we report that the tetraspanin CD81 enhances human immunodeficiency virus (HIV)-1 reverse transcription in HIV-1-infected cells. This is enabled by the direct interaction of CD81 with the deoxynucleoside triphosphate phosphohydrolase SAMHD1. This interaction prevents endosomal accumulation and
Diana Ayinde et al.
Journal of virology, 89(14), 6994-7006 (2015-05-01)
Monocyte-derived dendritic cells (MDDC) stimulate CD8 cytotoxic T lymphocytes (CTL) by presenting endogenous and exogenous viral peptides via major histocompatibility complex class I (MHC-I) molecules. MDDC are poorly susceptible to HIV-1, in part due to the presence of SAMHD1, a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service