Skip to Content
Merck
All Photos(1)

Key Documents

EHU136571

Sigma-Aldrich

MISSION® esiRNA

targeting human PREX1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGATGGGACAGCGGATTACCATAGCAACGGCTATACCGTCACCAACGGCTGGAAGATCCACAACACGGCCAAGAATAAGTGGTTTGTCTGCATGGCCAAGACGGCAGAGGAGAAGCAGAAGTGGCTGGATGCCATCATCCGCGAGCGGGAGCAGCGCGAGAGCCTGAAGCTGGGCATGGAGCGTGATGCCTACGTCATGATTGCGGAGAAGGGGGAGAAGCTGTACCACATGATGATGAACAAGAAGGTGAACCTCATCAAGGACCGCCGGAGAAAGCTGAGCACTGTCCCCAAGTGCTTTCTTGGCAATGAGTTCGTTGCCTGGCTCCTAGAAATTGGTGAAATCAGCAAGACGGAAGAAGGAGTCAACTTGGGCCAAGCCCTGTTGGAGAATGGCATCATCCACCATGTTTCCGACAAGCACCAGTTCAAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jinhua Wang et al.
Cancer letters, 407, 66-75 (2017-08-15)
P-REX1 (PIP3-dependent Rac exchange factor-1) is a guanine nucleotide exchange factor that activates Rac by catalyzing exchange of GDP for GTP bound to Rac. Aberrant up-regulation of P-REX1 expression has a role in metastasis however, copy number (CN) and function
Nimisha R Kumar et al.
Scientific reports, 9(1), 16980-16980 (2019-11-20)
Molecular factors altered in corneas that develop haze post refractive surgery have been described, but pre-existing factors that predispose clinically normal corneas to aberrant fibrosis post surgery and the role of the corneal epithelium remains unknown. We analyzed the global gene
L M Dillon et al.
Oncogene, 34(30), 3968-3976 (2014-10-07)
Phosphatidylinositol 3-kinase (PI3K) promotes cancer cell survival, migration, growth and proliferation by generating phosphatidylinositol 3,4,5-trisphosphate (PIP3) in the inner leaflet of the plasma membrane. PIP3 recruits pleckstrin homology domain-containing proteins to the membrane to activate oncogenic signaling cascades. Anticancer therapeutics

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service