Skip to Content
Merck
All Photos(1)

Key Documents

EHU076011

Sigma-Aldrich

MISSION® esiRNA

targeting human FCGRT

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTCCTGCTCTTTCTCCTTCCTGGGAGCCTGGGCGCAGAAAGCCACCTCTCCCTCCTGTACCACCTTACCGCGGTGTCCTCGCCTGCCCCGGGGACTCCTGCCTTCTGGGTGTCCGGCTGGCTGGGCCCGCAGCAGTACCTGAGCTACAATAGCCTGCGGGGCGAGGCGGAGCCCTGTGGAGCTTGGGTCTGGGAAAACCAGGTGTCCTGGTATTGGGAGAAAGAGACCACAGATCTGAGGATCAAGGAGAAGCTCTTTCTGGAAGCTTTCAAAGCTTTGGGGGGAAAAGGTCCCTACACTCTGCAGGGCCTGCTGGGCTGTGAACTGGGCCCTGACAACACCTCGGTGCCCACCGCCAAGTTCGCCCTGAACGGCGAGGAGTTCATGAATTTCGACCTCAAGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kunihiro Ichinose et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(4), 944-952 (2015-12-05)
Kidney podocytes and their slit diaphragms prevent urinary protein loss. T cells from patients with systemic lupus erythematosus display increased expression of calcium/calmodulin-dependent protein kinase IV (CaMKIV). The present study was undertaken to investigate the role of CaMKIV in podocyte
Huiqin Liu et al.
Journal of controlled release : official journal of the Controlled Release Society, 296, 40-53 (2019-01-18)
Pancreatic ductal adenocarcinoma (PDAC) is a dominantly (~95%) KRAS-mutant cancer that has extremely poor prognosis, in part this is due to its strong intrinsic resistance towards almost all therapeutic agents. PDAC relies heavily on KRAS-transformed metabolism, including enhanced macropinocytosis and
Rafal Swiercz et al.
Oncotarget, 8(2), 3528-3541 (2016-12-16)
Tumor cells rely on high concentrations of amino acids to support their growth and proliferation. Although increased macropinocytic uptake and lysosomal degradation of the most abundant serum protein, albumin, in Ras-transformed cells can meet these demands, it is not understood
Giovanni S Offeddu et al.
Biomaterials, 212, 115-125 (2019-05-22)
Recent therapeutic success of large-molecule biologics has led to intense interest in assays to measure with precision their transport across the vascular endothelium and into the target tissue. Most current in vitro endothelial models show unrealistically large permeability coefficients due

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service