Skip to Content
Merck
All Photos(1)

Key Documents

EHU069931

Sigma-Aldrich

MISSION® esiRNA

targeting human BTRC

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTGTGCCAGACTCTGCTTAAACCAAGAAACAGTATGTTTAGCAAGCACTGCTATGAAGACTGAGAATTGTGTGGCCAAAACAAAACTTGCCAATGGCACTTCCAGTATGATTGTGCCCAAGCAACGGAAACTCTCAGCAAGCTATGAAAAGGAAAAGGAACTGTGTGTCAAATACTTTGAGCAGTGGTCAGAGTCAGATCAAGTGGAATTTGTGGAACATCTTATATCCCAAATGTGTCATTACCAACATGGGCACATAAACTCGTATCTTAAACCTATGTTGCAGAGAGATTTCATAACTGCTCTGCCAGCTCGGGGATTGGATCATATTGCTGAGAACATTCTGTCATACCTGGATGCCAAATCACTATGTGCTGCTGAACTTGTGTGCAAGGAATGGTACCGAGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kazunori Hashimoto et al.
Antioxidants & redox signaling, 25(17), 953-964 (2016-06-02)
Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2) is the master transcriptional regulator of antioxidant gene expression. On increased oxidative stress, an adaptor for Nrf2 degradation, Kelch-like ECH-associated protein 1 (Keap1), is directly modulated by oxidants in the cytoplasm, which
Zhitian Shi et al.
Digestive diseases and sciences, 61(3), 785-794 (2015-11-02)
There is increasing evidence that histidine triad nucleotide-binding protein 1 (HINT1) is a novel tumor suppressor. In the present study, we investigated the mechanism by which HINT1 promotes the stability of inhibitor of NF-κB α (IκBα) in the cytoplasm of
Qijia Yan et al.
Oncotarget, 6(39), 41766-41782 (2015-10-27)
Epstein-Barr virus (EBV) infection is closely associated with tumorigenesis and development of nasopharyngeal carcinoma (NPC), but the underlying molecular mechanisms remain poorly understood. It has been recently reported that EBV encodes 44 mature miRNAs, some of which were found to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service