Skip to Content
Merck
All Photos(1)

Key Documents

EHU045551

Sigma-Aldrich

MISSION® esiRNA

targeting human STK39

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCACCCAATGCTAATGAAGACTACAGAGAAGCTTCTTCTTGTGCCGTGAACCTCGTTTTGAGATTAAGAAACTCCAGAAAGGAACTTAATGACATACGATTTGAGTTTACTCCAGGAAGAGATACAGCAGATGGTGTATCTCAGGAGCTCTTCTCTGCTGGCTTGGTGGATGGTCACGATGTAGTTATAGTGGCTGCTAATTTACAGAAGATTGTAGATGATCCCAAAGCTTTAAAAACATTGACATTTAAGTTGGCTTCTGGCTGTGATGGGTCGGAGATTCCTGATGAAGTGAAGCTGATTGGGTTTGCTCAGTTGAGTGTCAGCTGATGTATGTCCCTTGATGTCACCCTGATCTGTCATGCCCCACCGCCACCCCTACTCCCTTCAACCCTCCCTCTTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ken Yamada et al.
ACS chemical biology, 11(12), 3338-3346 (2016-10-08)
Protein kinases are known for their highly conserved adenosine triphosphate (ATP)-binding site, rendering the discovery of selective inhibitors a major challenge. In theory, allosteric inhibitors can achieve high selectivity by targeting less conserved regions of the kinases, often with an
Ye Bi et al.
Frontiers in physiology, 11, 638-638 (2020-07-28)
SPS1-related proline/alanine-rich kinase (SPAK) plays important roles in regulating the function of numerous ion channels and transporters. With-no-lysine (WNK) kinase phosphorylates SPAK kinase to active the SPAK signaling pathway. Our previous studies indicated that WNK kinases regulate the activity of
Xiuyan Feng et al.
American journal of physiology. Renal physiology, 308(10), F1119-F1127 (2015-03-13)
Thiazide-sensitive sodium chloride cotransporter (NCC) plays an important role in maintaining blood pressure. Aldosterone is known to modulate NCC abundance. Previous studies reported that dietary salts modulated NCC abundance through either WNK4 [with no lysine (k) kinase 4]-SPAK (Ste20-related proline

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service