Skip to Content
Merck
All Photos(1)

Key Documents

EMU153941

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ncl

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGGCAGAAATTGATGGACGATCTGTTTCACTCTACTATACTGGAGAGAAAGGTCAAAGGCAAGAGAGAACTGGAAAGACCAGCACTTGGAGTGGTGAATCAAAGACTTTGGTTTTAAGTAACCTTTCCTACAGTGCAACAAAAGAAACTCTTGAGGAAGTATTTGAGAAAGCAACTTTTATCAAAGTGCCCCAGAACCCACATGGCAAACCTAAAGGGTATGCATTTATAGAATTTGCTTCATTTGAAGATGCTAAAGAAGCTTTAAATTCCTGTAATAAAATGGAAATTGAGGGCAGAACAATCAGGCTGGAGTTGCAAGGATCCAATTCGAGAAGTCAACCATCCAAAACTCTGTTTGTCAAAGGTCTGTCTGAGGATACCACTGAAGAGACCTTAAAAGAATCATTTGAGGGCTCTGTTCGTGCAAGAATAGTCACTGATCGGGAAACTGGTTCTTCCAAAGGGTTTGGTTTTGTAGACTTTAATAGTGAGGAAGATGCCAAAGCT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

San-Cher Chen et al.
Oncotarget, 6(18), 16253-16270 (2015-05-06)
Hepatoma-derived growth factor (HDGF) overexpression is involved in liver fibrosis and carcinogenesis. However, the receptor(s) and signaling for HDGF remain unclear. By using affinity chromatography and proteomic techniques, nucleolin (NCL) was identified and validated as a HDGF-interacting membrane protein in
Dario Palmieri et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), 9418-9423 (2015-07-15)
Nucleolin (NCL) is a nucleocytoplasmic protein involved in many biological processes, such as ribosomal assembly, rRNA processing, and mRNA stabilization. NCL also regulates the biogenesis of specific microRNAs (miRNAs) involved in tumor development and aggressiveness. Interestingly, NCL is expressed on

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service