Skip to Content
Merck
All Photos(1)

Key Documents

EMU030691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Uhrf1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAAGCGGATGACAAGACTGTGTGGGAGGACACGGACCTGGGGCTGTACAAGGTCAATGAGTATGTGGACGTGCGTGACAATATCTTCGGTGCATGGTTTGAGGCCCAGGTGGTCCAGGTACAGAAGAGAGCCCTATCTGAGGACGAGCCCTGTAGCTCCAGTGCCGTTAAGACCTCGGAGGATGACATCATGTACCATGTCAAGTATGATGACTATCCAGAGCATGGAGTGGACATTGTCAAAGCCAAGAATGTCCGTGCTCGTGCTCGCACTGTGATACCATGGGAGAACCTGGAGGTGGGTCAGGTGGTCATGGCCAACTATAACGTGGACTACCCCAGGAAACGCGGCTTCTGGTATGATGTTGAGATCTGTAGGAAGCGCCAAACCAGGACGGCACGTGAGCTATACGGCAACATCAGGCTCTTGAATGACTCTCAGCTCAACAACTGTCGGATCATGTTTGTGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Feng Yan et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(11), 8887-8893 (2015-06-14)
Ubiquitin-like with PHD and ring finger domains 1 (UHRF1), known as ICB90 or Np95, has been found to be overexpressed in numerous cancers. In this study, we evaluated the expression level of UHRF1 in ovarian cancer. UHRF1 levels in paired
Yiyu Qin et al.
Oncology reports, 31(6), 2635-2643 (2014-04-24)
Ubiquitin-like containing PHD and RING finger domains 1 (UHRF1), overexpressed in various human malignancies, functions as an important regulator in cell proliferation and epigenetic regulation. Depletion of UHRF1 has shown potential antitumor activities in several types of cancer. However, the role

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service