Skip to Content
Merck
All Photos(1)

Documents

EMU011231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Il6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGGAGAGGAGACTTCACAGAGGATACCACTCCCAACAGACCTGTCTATACCACTTCACAAGTCGGAGGCTTAATTACACATGTTCTCTGGGAAATCGTGGAAATGAGAAAAGAGTTGTGCAATGGCAATTCTGATTGTATGAACAACGATGATGCACTTGCAGAAAACAATCTGAAACTTCCAGAGATACAAAGAAATGATGGATGCTACCAAACTGGATATAATCAGGAAATTTGCCTATTGAAAATTTCCTCTGGTCTTCTGGAGTACCATAGCTACCTGGAGTACATGAAGAACAACTTAAAAGATAACAAGAAAGACAAAGCCAGAGTCCTTCAGAGAGATACAGAAACTCTAATTCATATCTTCAACCAAGAGGTAAAAGATTTACATAAAATAGTCCTTCCTACCCCAATTTCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yong Xia et al.
Molecular and cellular biochemistry, 398(1-2), 147-156 (2014-09-23)
Piperine, a kind of natural alkaloid found in peppers, has been reported to exhibit anti-oxidative and anti-tumor activities, both in vitro and in vivo. Interleukin-6 (IL-6) is an important cytokine that activates the signal transduction, promotes tumor cell metastasis, and
Victoria Ingham et al.
Journal of neuroinflammation, 11, 115-115 (2014-06-24)
Activated microglia are associated with deposits of aggregated proteins within the brains of patients with Alzheimer's disease (AD), Parkinson's disease (PD) and prion diseases. Since the cytokines secreted from activated microglia are thought to contribute to the pathogenesis of these
Shijia Zhang et al.
Stem cells (Dayton, Ohio), 32(6), 1616-1628 (2014-01-23)
Adipose-derived stromal/stem cells (ASCs) have anti-inflammatory as well as immunosuppressive activities and are currently the focus of clinical trials for a number of inflammatory diseases. Acute lung injury (ALI) is an inflammatory condition of the lung for which standard treatment

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service