Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU178411

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stim2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGACCGTGGCTAAACCTGCAGGATCTTTAGCCAGAAGCAGTAGTTTATGCCGCTCTCGTCGCAGCATCGTGCCATCCTCCCCACAGTCTCAGCGAGCTCAGCTTCCTGCTCATGCTCCTCTGGCAGCCCACCCTCGGCACCCTCACCATCCGCAGCATCCCCAGCACTCGTTGCCTTCCCCAGATCCAGACATCCTGTCTGTGTCAAGTTGCCCTGCTCTGTATCGGAACGAAGAGGAGGAGGAGGCTATCTACTTCACTGCTGAGAAACAATGGGAAGTGCCAGACACAGCTTCAGAATGTGACTCCTTAAACTCTTCCAGTGGGAGAAAACCGTCTCCCCCTTCAAGCCTTGAGATGTACCAAACATTGTCTTCCCGAAAAATCTCAAGAGACGAGCTTTCCCTGGAGGACTCTTCCAGGGGGGAGTCACCCGTGACAGCAGATGTCTCCCGGGGCTCCCCTGAGTGTGTGGGTCTGACGGAGACCAAGAGCATGATCTTCAGCCCTGCAAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Raz Palty et al.
Cell research, 25(8), 963-980 (2015-07-04)
Calcium flux through store-operated calcium entry is a major regulator of intracellular calcium homeostasis and various calcium signaling pathways. Two key components of the store-operated calcium release-activated calcium channel are the Ca(2+)-sensing protein stromal interaction molecule 1 (STIM1) and the
Ruby A Fernandez et al.
American journal of physiology. Cell physiology, 308(8), C581-C593 (2015-02-13)
Pulmonary arterial hypertension (PAH) is a progressive disease that, if left untreated, eventually leads to right heart failure and death. Elevated pulmonary arterial pressure (PAP) in patients with PAH is mainly caused by an increase in pulmonary vascular resistance (PVR).
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico