Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU088941

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bcl2l1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGACAATGGACTGGTTGAGCCCATCTCTATTATAAAAATGTCTCAGAGCAACCGGGAGCTGGTGGTCGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCTGGAGTCAGTTTAGTGATGTCGAAGAGAATAGGACTGAGGCCCCAGAAGAAACTGAAGCAGAGAGGGAGACCCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCGGATAGCCCGGCCGTGAATGGAGCCACTGGCCACAGCAGCAGTTTGGATGCGCGGGAGGTGATTCCCATGGCAGCAGTGAAGCAAGCGCTGAGAGAGGCAGGCGATGAGTTTGAACTGCGGTACCGGAGAGCGTTCAGTGATCTAACATCCCAGCTTCACATAACCCCAGGGACCGCGTATCAGAGCTTTGAGCAGGTAGTGAATGAACTCTTTCGGGATGGAGTAAACTGGGGTCGCATCGTGGCCTTTTTCTCCTTTGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATGCAGGTATTGGTGAGTCGGATTGCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Laijun Lai et al.
PloS one, 8(12), e82998-e82998 (2013-12-19)
T cell immunodeficiency is a major complication of bone marrow (BM) transplantation (BMT). Therefore, approaches to enhance T cell reconstitution after BMT are required. We have purified a hybrid cytokine, consisting of IL-7 and the β-chain of hepatocyte growth factor
David Chiron et al.
Oncotarget, 6(11), 8750-8759 (2015-03-24)
The aggressive biological behavior of mantle cell lymphoma (MCL) and its short response to current treatment highlight a great need for better rational therapy. Herein, we investigate the ability of ABT-199, the Bcl-2-selective BH3 mimetic, to kill MCL cells. Among
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Yoko Hari et al.
Oncotarget, 6(39), 41902-41915 (2015-10-28)
Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) induces apoptosis in various types of cancer cells without damaging normal cells. However, in terms of pancreatic cancer, not all cancer cells are sensitive to TRAIL. In this study, we examined a panel
S Marina Casalino-Matsuda et al.
Journal of immunology (Baltimore, Md. : 1950), 194(11), 5388-5396 (2015-04-22)
Hypercapnia, the elevation of CO2 in blood and tissue, commonly develops in patients with advanced lung disease and severe pulmonary infections, and it is associated with high mortality. We previously reported that hypercapnia alters expression of host defense genes, inhibits

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico