Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU060431

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Traf2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAATGATGCTCTGTTGCAGTGGCCTTTTAATCAGAAGGTAACATTGATGTTGCTGGACCATAACAACCGGGAGCATGTGATCGACGCATTCAGGCCCGATGTAACCTCGTCCTCCTTCCAGAGGCCTGTCAGTGACATGAACATCGCCAGTGGCTGCCCCCTCTTCTGCCCTGTGTCCAAGATGGAGGCCAAGAATTCCTATGTGCGGGATGATGCGATCTTCATCAAAGCTATTGTGGACCTAACAGGACTCTAGCCACCCCTGCTAAGAATAGCAGCTCAGTGAGGAGCTGTCACATTAGGCCAGCCAGGCCCTGCCACACACGGGTGGGCAGGCTTGGTGTAAATGCTGGGGAGGGCCTCAGCCTAGAGCCAATCACCATCACACAGAAAGGCAGGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hong Cheng et al.
The Journal of investigative dermatology, 135(10), 2427-2436 (2015-05-29)
Previously, tumor necrosis factor (TNF)-like weak inducer of apoptosis (TWEAK) had been known to be an inducer of apoptosis of keratinocytes by engaging the Fn14 receptor. However, the high-risk human papillomavirus (HPV) infection confers a proliferation advantage on keratinocytes that
I Karl et al.
Cell death & disease, 5, e1444-e1444 (2014-10-10)
The relevance of the adaptor protein TNF receptor-associated factor 2 (TRAF2) for signal transduction of the death receptor tumour necrosis factor receptor1 (TNFR1) is well-established. The role of TRAF2 for signalling by CD95 and the TNF-related apoptosis inducing ligand (TRAIL)
Alexey V Sorokin et al.
Cancer research, 75(9), 1846-1858 (2015-04-17)
The protein tyrosine phosphatase receptor PTPRN2 is expressed predominantly in endocrine and neuronal cells, where it functions in exocytosis. We found that its immature isoform proPTPRN2 is overexpressed in various cancers, including breast cancer. High proPTPRN2 expression was associated strongly

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico