Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU056071

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mavs

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAGGAAGCCCTGAGCCACTAGCCACCCAGCAGCCCCAAGAAGAGGAAGAACATTGTGCCAGTTCAATGCCCTGGGCTAAGTGGCTTGGGGCCACCAGTGCACTCTTGGCTGTATTCCTGGCAGTGATGCTGTACCGTAGTAGGCGCCTGGCCCAGTGAAGCCTCAGCTGTATGCTGTTCTCTTGCTCAGTTCTGCCAAGCATGTTCTCTAGGCTTGGGCTAGTAGAGGCTGAGTCAGAGAAACTTAAATATGGCGAGGTCCACTGAGCTATCCAGGTAGATAGCTACACCAAGACGTCATCACTGTTGGGTGGGGGAGAGACATTGTTTTATCCTGGTTCATATGTCATCTTCTGGTCTTCAGCTTTTGGAGGCACTGTGTTACCTCCATTGCTCCTGACCTGCCCACGTGGCAGTGTAAGAGTTCATGCTCTGTGCTCCTAAGGAGGTATCTCCACCAGCTTTATCCCTGTTGGCCCAAGCCTGAAGATGAGGAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Pradip B Devhare et al.
PloS one, 8(5), e63793-e63793 (2013-05-15)
Hepatitis E virus (HEV) is a major cause of enterically transmitted acute hepatitis in developing nations and occurs in sporadic and epidemic forms. The disease may become severe with high mortality (20%) among pregnant women. Due to lack of efficient
Charlotte Odendall et al.
Nature immunology, 15(8), 717-726 (2014-06-24)
Type I interferon responses are considered the primary means by which viral infections are controlled in mammals. Despite this view, several pathogens activate antiviral responses in the absence of type I interferons. The mechanisms controlling type I interferon-independent responses are
Huachen Gan et al.
Scientific reports, 5, 17916-17916 (2015-12-09)
Influenza A virus (IAV) targets airway epithelial cells and exploits the host cell machinery to replicate, causing respiratory illness in annual epidemics and pandemics of variable severity. The high rate of antigenic drift (viral mutation) and the putative antigenic shift

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico