Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU037611

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Twist1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCCCACGAGCGGCTCAGCTACGCCTTCTCCGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAGCAGCGGAGCTCCCCACCCCCTCTGCAGGCCGGAGACCTAGATGTCATTGTTTCCAGAGAAGGAGAAAATGGACAGTCTAGAGACTCTGGAGCTGGATAACTAAAAATAAATCTATATGACAAAGATTTTCATGGAAATTAGAAGAGCAGAGACCAAATTCACAAGAATCAGGGCGTGGGGCACACTTTTAAAAGAGAAAGCGAGACAGGCCCGTGGACAGAGATTCCCAGAGGGGCAGCAGCAGACCCCCCACACCTCTGCATTCTGATAGAAGTCTGAACACTCGTTTGTGTCCCCCCACCCCACTTTTTGACGAAGAATGTTTTATTTTTATTTTTCATGCATGCATTCTCAAGAGGTCTTGCCAATCAGCCACTGACAGGAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shasha Zheng et al.
Journal of immunology (Baltimore, Md. : 1950), 195(1), 217-226 (2015-05-29)
Proper regulation of microbial-induced cytokines is critical to intestinal immune homeostasis. Acute stimulation of nucleotide-binding oligomerization domain 2 (NOD2), the Crohn's disease-associated sensor of bacterial peptidoglycan, induces cytokines. However, chronic NOD2 stimulation in macrophages decreases cytokines upon pattern recognition receptor
Rosemarie Chirco D'Angelo et al.
Molecular cancer research : MCR, 12(9), 1324-1333 (2014-06-05)
Tissue inhibitor of metalloproteinase-1 (TIMP-1) regulates intracellular signaling networks for inhibition of apoptosis. Tetraspanin (CD63), a cell surface binding partner for TIMP-1, was previously shown to regulate integrin-mediated survival pathways in the human breast epithelial cell line MCF10A. In the
Lihua Yang et al.
Scientific reports, 5, 13677-13677 (2015-09-04)
Understanding the molecular mechanism by which epithelial mesenchymal transition (EMT)-mediated cancer metastasis and how microRNA (miRNA) regulates lung cancer progression via Twist1-activated EMT may provide potential therapeutic targets for cancer therapy. Here we found that miR-33a, an intronic miRNA located

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico