Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU026991

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mdm2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTTTGGAGTCCCGAGTTTCTCTGTGAAGGAGCACAGGAAAATATATGCAATGATCTACAGAAATTTAGTGGCTGTAAGTCAGCAAGACTCTGGCACATCGCTGAGTGAGAGCAGACGTCAGCCTGAAGGTGGGAGTGATCTGAAGGATCCTTTGCAAGCGCCACCAGAAGAGAAACCTTCATCTTCTGATTTAATTTCTAGACTGTCTACCTCATCTAGAAGGAGATCCATTAGTGAGACAGAAGAGAACACAGATGAGCTACCTGGGGAGCGGCACCGGAAGCGCCGCAGGTCCCTGTCCTTTGATCCGAGCCTGGGTCTGTGTGAGCTGAGGGAGATGTGCAGCGGCGGCAGCAGCAGCAGTAGCAGCAGCAGCAGCGAGTCCACAGAGACGCCCTCGCATCAGGATCTTGACGATGGCGTAAGTGAGCATTCTGGTGATTGCCTGGATCAGGAT

Ensembl | mouse accession no.

ENSMUSG00000020184

NCBI accession no.

NM_010786

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... MDM2(17246) , Mdm2(17246)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Eva Slabáková et al.
Oncotarget, 6(34), 36156-36171 (2015-09-30)
Plasticity of cancer cells, manifested by transitions between epithelial and mesenchymal phenotypes, represents a challenging issue in the treatment of neoplasias. Both epithelial-mesenchymal transition (EMT) and mesenchymal-epithelial transition (MET) are implicated in the processes of metastasis formation and acquisition of
Shaneabbas Raza et al.
Molecular and cellular biochemistry, 410(1-2), 187-195 (2015-09-10)
Estrogen is synthesized from cholesterol and high cholesterol levels are suggested to be associated with increased risk of estrogen receptor(ER)-positive breast cancer. The cholesterol metabolite 27-hydroxycholesterol (27-OHC) was recently identified as a selective estrogen receptor modulator (SERM) and may therefore
Seemana Bhattacharya et al.
The FEBS journal, 281(13), 3061-3078 (2014-05-16)
Tumor suppressor retinoblastoma-associated protein (Rb) is an important cell cycle regulator, arresting cells in early G1. It is commonly inactivated in cancers and its level is maintained during the cell cycle. Rb is regulated by various post-translational modifications such as
Hong Zhu et al.
Oncotarget, 6(5), 3254-3267 (2014-09-17)
Adriamycin, a widely used anthracycline antibiotic in multiple chemotherapy regimens, has been challenged by the cardiotoxicity leading to fatal congestive heart failure in the worst condition. The present study demonstrated that Dihydromyricetin, a natural product extracted from ampelopsis grossedentat, exerted
Jiang-Jiang Qin et al.
Oncotarget, 6(5), 2623-2640 (2015-03-05)
The MDM2 oncogene has been suggested as a molecular target for treating human cancers, including breast cancer. Most MDM2 inhibitors under development are targeting the MDM2-p53 binding, and have little or no effects on cancers without functional p53, such as
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico