Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU024671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sub1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGATTCGGACAGCGAAGTTGAAAAAAAGTTAAAGAGGAAAAAGCAAGCGGTTCCAGAGAAGCCCGTGAAGAAGCAGAAGCCTGGTGAGACTTCTAGAGCACTGGCATCCTCCAAGCAGAGCAGCAGCAGCAGAGATGACAACATGTTCCAGATTGGAAAGATGAGATATGTCAGTGTTCGGGACTTCAAAGGAAAAATTCTAATTGATATTAGAGAATATTGGATGGATTCAGAAGGTGAAATGAAACCAGGAAGAAAAGGTATTTCTTTAAACATGGAACAATGGAGCCAGCTGAAGGAACAGATCTCTGATATAGATGACGCAGTAAGAAAGCTGTAAAATCTGAGCCATATCAAACCTGTACTGTTGTAGTTGTCTTTTTACATTGGCTTTTGTTTTCTAAATGTTGTTTTCCAAGCTGTTGTATATTTGGATTGCAGAACAATTTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shaolin Tao et al.
American journal of cancer research, 5(6), 1878-1889 (2015-08-14)
Human transcriptional positive cofactor 4 (PC4) is a novel marker for diagnosis and treatment of advanced human cancers metastasis. In human lung adenocarcinoma, tumor lymphangiogenesis, an important early event, can promotes lymphatic metastasis, while it has been reported that VEGF-C/VEGF-D/VEGFR-3
Shin-Hee Heo et al.
Cancer letters, 362(1), 139-148 (2015-04-02)
All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, has been extensively studied for the prevention and treatment of cancer; however, the underlying mechanism of its anti-cancer potential is still unclear. Here we found that ATRA induces
Young Lan Seo et al.
The Journal of general virology, 96(Pt 4), 822-832 (2014-12-24)
Infection with hepatitis C virus (HCV) is characterized by systemic oxidative stress that is caused by either viral core protein or chronic inflammation. It is well recognized that reactive oxygen species (ROS) such as H2O2 can induce apoptotic cell death

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico