Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU018761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Furin

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAGCCAAGAGGGACGTGTATCAGGAGCCCACGGACCCCAAGTTCCCCCAGCAGTGGTACCTGTCTGGTGTCACTCAGCGAGACCTGAATGTGAAGGAGGCCTGGGCCCAGGGCTTCACAGGCCATGGCATTGTGGTCTCCATCCTGGATGACGGCATTGAGAAGAATCATCCCGACCTAGCAGGCAATTATGACCCTGGAGCCAGTTTTGACGTGAATGACCAGGACCCCGACCCACAGCCTCGGTACACACAGATGAATGACAACAGGCATGGCACTCGCTGTGCCGGGGAAGTGGCAGCAGTGGCCAACAATGGTGTCTGTGGCGTAGGTGTAGCTTACAATGCCCGAATTGGAGGGGTGCGGATGTTGGATGGCGAGGTGACTGATGCAGTAGAGGCACGTTCGCTGGGCCTGAATCCCAACCACATCCACAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Z Zhou et al.
Cell death & disease, 4, e593-e593 (2013-04-20)
The multinucleated syncytial trophoblast, which forms the outermost layer of the placenta and serves multiple functions, is differentiated from and maintained by cytotrophoblast cell fusion. Deficiencies in syncytial trophoblast differentiation or maintenance likely contribute to intrauterine growth restriction and pre-eclampsia
Xiaokui Yang et al.
PloS one, 8(2), e50479-e50479 (2013-02-19)
Folliculogenesis is tightly controlled by a series of hormones, growth factors and cytokines, many of which are secreted as proproteins and require processing by proteases before becoming functional. Furin is a member of the subtilisin-like proteases that activate large numbers
Diana Farhat et al.
British journal of cancer, 122(6), 885-894 (2020-01-29)
Breast cancer is the second most common cancer in the world. Despite advances in therapies, the mechanisms of resistance remain the underlying cause of morbidity and mortality. Lipoic acid (LA) is an antioxidant and essential cofactor in oxidative metabolism. Its
Jian Fu et al.
Molecular carcinogenesis, 54(9), 698-706 (2014-01-18)
Proprotein convertases (PC), a family of serine proteases, process cancer-related substrates such as growth factors, growth factor receptors, cell adhesion molecules, metalloproteinases, etc. HIF-1α is a major transcription factor involved in tumorigenesis by sensing intratumoral hypoxia. Furin (PCSK3) is one

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico