Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU016791

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prmt1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGATGGGTTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTGCACGCTCGGGACAAGTGGCTGGCACCCGATGGCCTCATCTTCCCAGACCGGGCCACCTTGTATGTGACAGCCATTGAGGACCGACAATATAAAGACTACAAGATCCACTGGTGGGAGAACGTGTATGGCTTTGATATGTCCTGCATTAAAGACGTGGCCATCAAGGAGCCCCTGGTGGACGTGGTGGACCCAAAGCAGCTGGTCACCAATGCCTGCCTCATAAAGGAGGTGGACATTTACACAGTCAAGGTGGAGGACCTGACCTTCACCTCCCCCTTCTGCCTGCAAGTGAAGAGGAACGACTACGTGCACGCGCTGGTGGCTTACTTCAACATCGAGTTCACCCGATGCCACAAGAGGACCGGCTTCTCCACCAGTCCTGAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sreedevi Avasarala et al.
The Journal of biological chemistry, 290(21), 13479-13489 (2015-04-08)
Protein arginine methyl transferase 1 (PRMT1) was shown to be up-regulated in cancers and important for cancer cell proliferation. However, the role of PRMT1 in lung cancer progression and metastasis remains incompletely understood. In the present study, we show that
Bingshou Li et al.
Biochemical and biophysical research communications, 464(4), 982-987 (2015-07-15)
Accumulating evidence indicates that microRNAs function as oncogenes or tumor suppressor genes in human cancer. MiR-503 is deregulated in various human cancers and has been associated with hepatocellular carcinoma (HCC) progression. However, the underlying mechanisms of miR-503 involvement in the
Dong-Il Kim et al.
Oxidative medicine and cellular longevity, 2015, 617919-617919 (2015-11-20)
Oxidative stress-induced retinal pigment epithelial (RPE) cell damage is involved in the progression of diabetic retinopathy. Arginine methylation catalyzed by protein arginine methyltransferases (PRMTs) has emerged as an important histone modification involved in diverse diseases. Sirtuin (SIRT1) is a protein

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico