Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU012511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Slc1a7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATCCTCACCGTGGCATACTACCTGTGGACTACCTTTCTGGCTGTTGTTGTGGGCATCATCATGGTCTCCATCATCCACCCTGGTGGTGCAGCACAGAAGGAGACAACTGAACAGAGTGGAAAGCCGGTCATGAGCTCAGCTGATGCCCTCCTGGATCTTGTCCGGAACATGTTCCCAGCCAACCTGGTAGAAGCCACGTTCAAACAGTACCGCACCAAGACCACCCCAGTTATCAAGTCTCCCAGGGGAGCAGCGGAGGAGGCTCCCCGGCGGATCGTCATCTATGGGGTCCAGGAAGACAATGGCTCACGTGTGCAGAACTTTGCCCTGGATCTGACGCCCCCACCTGAGATTGTCTACAAGTCAGAGCCTGGTACCAGTGATGGCATGAACGTGCTAGGCATTGTCATCTTCTCAGCCACG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Aoula Al-Zebeeby et al.
Haematologica, 104(5), 1016-1025 (2018-11-24)
BH3 mimetics are novel targeted drugs with remarkable specificity, potency and enormous potential to improve cancer therapy. However, acquired resistance is an emerging problem. We report the rapid development of resistance in chronic lymphocytic leukemia cells isolated from patients exposed
Michael L Schulte et al.
Nature medicine, 24(2), 194-202 (2018-01-16)
The unique metabolic demands of cancer cells underscore potentially fruitful opportunities for drug discovery in the era of precision medicine. However, therapeutic targeting of cancer metabolism has led to surprisingly few new drugs to date. The neutral amino acid glutamine
Florian Beaumatin et al.
Molecular cell, 76(1), 163-176 (2019-09-08)
Sensing nutrient availability is essential for appropriate cellular growth, and mTORC1 is a major regulator of this process. Mechanisms causing mTORC1 activation are, however, complex and diverse. We report here an additional important step in the activation of mTORC1, which

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico