Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU009181

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ly6a

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAGTCCTCCTGCAGACCTTGCTCTGATGGTCCTCCCAATGACCTCCACCCTTGTCCTTTTATCCTCATGTGCAACAATTCTTCCTGGAGCCCTCTAGTGATGAATTATGAGTTATAGAAGCTCCAAGGTGGGAGTAGTGTGTGAAATACCATGTTTTGCCTTTATAGCCCCTGCTGGGTAGGTAGGTGCTCTAATCCTCTCTAGGGCTTTCAAGTCTGTACTTCCTAGAATGTCATTTTGTTGTGGATTGCTGCTCATGACCCTGGAGGCACACAGCCAGCACAGTGAAGAGGCAGAATTCCAAGGTATTATGCTATCACCATCCACACATAAGTATCTGGGGTCCTGCAATGTTCCCACATGTATCCTGAATGTCCCCCTGTTGAGTCCAATAAACCCTTTGTTCTCCCAAAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaohua Jia et al.
BMC nephrology, 13, 105-105 (2012-09-12)
Bone marrow (BM) stem cells have been reported to contribute to tissue repair after kidney injury model. However, there is no direct evidence so far that BM cells can trans-differentiate into renal stem cells. To investigate whether BM stem cells
Yu-Chiao Hsu et al.
PloS one, 9(2), e88966-e88966 (2014-03-04)
Stem cell antigen-1 (Ly6a/Sca-1) is a gene that is expressed in activated lymphocytes, hematopoietic stem cells and stem cells of a variety of tissues in mice. Despite decades of study its functions remain poorly defined. These studies explored the impact
Hao Wang et al.
BMC biotechnology, 14, 75-75 (2014-08-12)
Myocardial infarction remains the leading cause of mortality in developed countries despite recent advances in its prevention and treatment. Regenerative therapies based on resident cardiac progenitor cells (CPCs) are a promising alternative to conventional treatments. However, CPCs resident in the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico