Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU007831

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Birc2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGTGTTCATTCCGTGTGGTCATCTAGTAGTCTGCCAGGAATGTGCCCCTTCTCTAAGGAAGTGCCCCATCTGCAGGGGGACAATCAAGGGGACTGTGCGCACATTTCTCTCATGAGTGAAGAATGGTCTGAAAGTATTGTTGGACATCAGAAGCTGTCAGAACAAAGAATGAACTACTGATTTCAGCTCTTCAGCAGGACATTCTACTCTCTTTCAAGATTAGTAATCTTGCTTTATGAAGGGTAGCATTGTATATTTAAGCTTAGTCTGTTGCAAGGGAAGGTCTATGCTGTTGAGCTACAGGACTGTGTCTGTTCCAGAGCAGGAGTTGGGATGCTTGCTGTATGTCCTTCAGGACTTCTTGGATTTGGAATTTGTGAAAGCTTTGGATTCAGGTGATGTGGAGCTCAGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

M Lappas
Placenta, 35(10), 831-838 (2014-08-13)
Independent of their role in apoptosis, cellular inhibitors of apoptosis (cIAP) 1 and 2, have emerged as regulators of inflammation. Obesity in pregnancy is characterised by maternal and placental inflammation. Thus, the aim of this study was to determine the
Hong Jin et al.
Oncology research, 22(3), 167-176 (2015-07-15)
Emerging evidence suggests a potential role of cellular inhibitor of apoptosis protein 1 (cIAP1) in the development of human ovarian cancer. However, its function in the progression of ovarian cancer has not been clearly determined. Our study aimed to investigate
E-W Lee et al.
Cell death and differentiation, 22(9), 1463-1476 (2015-01-24)
Given their crucial role in apoptosis suppression, inhibitor of apoptosis proteins (IAPs) have recently become attractive targets for cancer therapy. Here, we report that cellular IAP2 (cIAP2) is specifically stabilized in several cancer cell lines, leading to resistance to Smac

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico