Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU158661

Sigma-Aldrich

MISSION® esiRNA

targeting human NONO

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAAATCTTCCTCCCGACATCACTGAGGAAGAAATGAGGAAACTATTTGAGAAATATGGAAAGGCAGGCGAAGTCTTCATTCATAAGGATAAAGGATTTGGCTTTATCCGCTTGGAAACCCGAACCCTAGCGGAGATTGCCAAAGTGGAGCTGGACAATATGCCACTCCGTGGAAAGCAGCTGCGTGTGCGCTTTGCCTGCCATAGTGCATCCCTTACAGTTCGAAACCTTCCTCAGTATGTGTCCAACGAACTGCTGGAAGAAGCCTTTTCTGTGTTTGGCCAGGTAGAGAGGGCTGTAGTCATTGTGGATGATCGAGGAAGGCCCTCAGGAAAAGGCATTGTTGAGTTCTCAGGGAAGCCAGCTGCTCGGAAAGCTCTGGACAGATGCAGTGAAGGCTCCTTCCTGCTAACCACATTTCCTCGTCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Taotao Han et al.
The Journal of clinical investigation, 130(7), 3901-3918 (2020-06-17)
Chronic infections can lead to carcinogenesis through inflammation-related mechanisms. Chronic infection of the human gastric mucosa with Helicobacter pylori is a well-known risk factor for gastric cancer. However, the mechanisms underlying H. pylori-induced gastric carcinogenesis are incompletely defined. We aimed
Rui Cheng et al.
Oncology reports, 39(6), 2575-2583 (2018-04-06)
Esophageal squamous cell carcinoma (ESCC) is one of the most common malignancies in China, and is associated with high morbidity and mortality. However, the molecular mechanisms that control ESCC tumorigenicity and metastasis remain unclear. Here, we report that the RNA
Lotte Victoria Winther Stagsted et al.
eLife, 10 (2021-01-22)
Circular RNAs (circRNAs) represent an abundant and conserved entity of non-coding RNAs; however, the principles of biogenesis are currently not fully understood. Here, we identify two factors, splicing factor proline/glutamine rich (SFPQ) and non-POU domain-containing octamer-binding protein (NONO), to be
Asma Chaoui et al.
Human molecular genetics, 24(17), 4933-4947 (2015-06-11)
SOX10 is a transcription factor with well-known functions in neural crest and oligodendrocyte development. Mutations in SOX10 were first associated with Waardenburg-Hirschsprung disease (WS4; deafness, pigmentation defects and intestinal aganglionosis). However, variable phenotypes that extend beyond the WS4 definition are

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico