Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU158351

Sigma-Aldrich

MISSION® esiRNA

targeting human PMEPA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGGTGCCTAGCTTGGTGAGGTTACTCCTGCTCCTCCAACCTTTTTTTGCCAAGGTTTGTACACGACTCCCATCTAGGCTGAAAACCTAGAAGTGGACCTTGTGTGTGTGCATGGTGTCAGCCCAAAGCCAGGCTGAGACAGTCCTCATATCCTCTTGAGCCAAACTGTTTGGGTCTCGTTGCTTCATGGTATGGTCTGGATTTGTGGGAATGGCTTTGCGTGAGAAAGGGGAGGAGAGTGGTTGCTGCCCTCAGCCGGCTTGAGGACAGAGCCTGTCCCTCTCATGACAACTCAGTGTTGAAGCCCAGTGTCCTCAGCTTCATGTCCAGTGGATGGCAGAAGTTCATGGGGTAGTGGCCTCTCAAAGGCTGGGCGCATCCCAAGACAGCCAGCAGGTTGTCTCTGGAAACGACCAGAGTTAAGCTCTCGGCTTCTCTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Riezki Amalia et al.
Cellular signalling, 59, 24-33 (2019-03-21)
Transmembrane prostate androgen-induced protein (TMEPAI) is a type I transmembrane protein induced by several intracellular signaling pathways such as androgen, TGF-β, EGF, and Wnt signaling. It has been reported that TMEPAI functions to suppress TGF-β and androgen signaling but here
Yuyin Li et al.
Cell proliferation, 49(6), 710-719 (2016-11-04)
TMEPAI (transmembrane prostate androgen-induced protein) has been reported to be overexpressed during tumour progression; however, little is known concerning transcriptional mechanisms regulating TMEPAI gene expression. In this study, the TMEPAI gene promoter has been identified and characterized, and the effects
Noboru Funakubo et al.
Journal of cellular physiology, 233(4), 3105-3118 (2017-08-13)
Osteoclasts are multinucleated cells formed by fusion of preosteoclasts (POCs) derived from cells of the monocyte/macrophage lineage. We have reported a culture system that supports the formation of POCs from stroma-depleted rat bone marrow cells. Global gene expression analysis of
Hua Li et al.
Oncotarget, 6(17), 15137-15149 (2015-04-18)
Androgen Receptor (AR) is the male hormone receptor and a nuclear transcription factor which plays a central role in the growth of normal and malignant prostate gland. Our earlier studies defined a mechanistic model for male hormone dependent regulation of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico