Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU154291

Sigma-Aldrich

MISSION® esiRNA

targeting human ERCC4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGAGCCAAGATACGTGGTTCTTTATGACGCAGAGCTAACCTTTGTTCGGCAGCTTGAAATTTACAGGGCGAGTAGGCCTGGGAAACCTCTGGTTTACTTTCTTATATACGGAGGTTCAACTGAGGAACAACGCTATCTCACTGCTTTGCGGAAAGAAAAGGAAGCTTTTGAAAAACTCATAAGGGAAAAAGCAAGCATGGTTGTCCCTGAAGAAAGAGAAGGCAGAGATGAAACAAACTTAGACCTAGTAAGAGGCACAGCATCTGCAGATGTTTCCACTGACACTCGGAAAGCCGGTGGCCAGGAACAGAATGGTACACAGCAAAGCATAGTTGTGGATATGCGTGAATTTCGAAGTGAGCTTCCATCTCTGATCCATCGTCGGGGCATTGACATTGAACCCGTGACTTTAGAGGTTGGAGATTACATCCTCACTCCAGAAATGTGCGTGGAGCGCAAGAGTATCAGTGATTTAATCGGCTCTTTAAATAACGGCCGCCTCTACAGCCAGTGCATCTCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Barbara Steurer et al.
Nucleic acids research, 47(7), 3536-3549 (2019-01-31)
UV light induces cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts (6-4PPs), which can result in carcinogenesis and aging, if not properly repaired by nucleotide excision repair (NER). Assays to determine DNA damage load and repair rates are invaluable tools
Katia A Mesquita et al.
Gynecologic oncology, 153(2), 416-424 (2019-02-25)
PARP inhibitor maintenance therapy in platinum sensitive sporadic ovarian cancers improves progression free survival. However, biomarker for synthetic lethality in platinum sensitive sporadic disease is yet to be defined. ERCC1-XPF heterodimer is a key player in nucleotide excision repair (NER)
Haiqing Fu et al.
Nature communications, 6, 6746-6746 (2015-04-17)
The Mus81 endonuclease resolves recombination intermediates and mediates cellular responses to exogenous replicative stress. Here, we show that Mus81 also regulates the rate of DNA replication during normal growth by promoting replication fork progression while reducing the frequency of replication

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico