Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU151431

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPG2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTTTGCCTGCCACAGCTACAATGAGTGTGTGGCCCTGGAGTATCGCTGTGACCGGCGGCCCGACTGCAGGGACATGTCTGATGAGCTCAATTGTGAGGAGCCAGTCCTGGGTATCAGCCCCACATTCTCTCTCCTTGTGGAGACGACATCTTTACCGCCCCGGCCAGAGACAACCATCATGCGACAGCCACCAGTCACCCACGCTCCTCAGCCCCTGCTTCCCGGTTCCGTCAGGCCCCTGCCCTGTGGGCCCCAGGAGGCCGCATGCCGCAATGGGCACTGCATCCCCAGAGACTACCTCTGCGACGGACAGGAGGACTGCGAGGACGGCAGCGATGAGCTAGACTGTGGCCCCCCGCCACCCTGTGAGCCCAACGAGTTCCCCTGCGGGAATGGACATTGTGCCCTCAAGCTGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Osama Garwain et al.
Cellular signalling, 71, 109620-109620 (2020-04-05)
Alzheimer's disease is typified by calcium dysfunction and neurofibrillary tangles of tau aggregates along with mitotic proteins. Using PC12 cells as a model system, we determined whether the Gαq/PLCβ/ calcium signaling pathway impacts the manifestation of Alzheimer's disease. Down-regulating PLCβ
Anne M Roesler et al.
Journal of cellular physiology, 234(8), 14187-14197 (2019-01-10)
Airway smooth muscle (ASM) regulation of airway structure and contractility is critical in fetal/neonatal physiology in health and disease. Fetal lungs experience higher Ca2+ environment that may impact extracellular Ca2+ ([Ca2+ ]o ) sensing receptor (CaSR). Well-known in the parathyroid
Cristián Ibarra et al.
Molecular oncology, 13(2), 202-211 (2018-10-26)
Bacillus Calmette-Guérin (BCG) is widely used in the clinic to effectively treat superficial urinary bladder cancer. However, a significant proportion of patients who fail to respond to BCG risk cystectomy or death. Though more than 3 million cancer treatments with

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico