Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU137841

Sigma-Aldrich

MISSION® esiRNA

targeting human CENPE

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGCTTGAGTTGGCTCAGAAACTTAATGAAAATTATGAGGAAGTGAAATCTATAACCAAAGAAAGAAAAGTTCTAAAGGAATTACAGAAGTCATTTGAAACAGAGAGAGACCACCTTAGAGGATATATAAGAGAAATTGAAGCTACAGGCCTACAAACCAAAGAAGAACTAAAAATTGCTCATATTCACCTAAAAGAACACCAAGAAACTATTGATGAACTAAGAAGAAGCGTATCTGAGAAGACAGCTCAAATAATAAATACTCAGGACTTAGAAAAATCCCATACCAAATTACAAGAAGAGATCCCAGTGCTTCATGAGGAACAAGAGTTACTGCCTAATGTGAAAGAAGTCAGTGAGACTCAGGAAACAATGAATGAACTGGAGTTATTAACAGAACAGTCCACAACCAAGGACTCAACAACACTGGCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zijie Liu et al.
Journal of experimental & clinical cancer research : CR, 28, 156-156 (2009-12-22)
CENP-E, one of spindle checkpoint proteins, plays a crucial role in the function of spindle checkpoint. Once CENP-E expression was interrupted, the chromosomes can not separate procedurally, and may result in aneuploidy which is a hallmark of most solid cancers
Carmen Taveras et al.
Cell cycle (Georgetown, Tex.), 18(12), 1349-1363 (2019-05-28)
During mitosis, Aurora B kinase is required for forming proper bi-oriented kinetochore-microtubule attachments. Current models suggest that tension exerted between a pair of sister-kinetochores (inter-kinetochore stretch) produces a spatial separation of Aurora B kinase from kinetochore-associated microtubule binding substrates, such
Lina Shan et al.
International journal of oncology, 55(1), 257-266 (2019-05-23)
Lung cancer is the most common and most lethal type of cancer. A sustained proliferative capacity is one of the hallmarks of cancer, and microtubules serve an important role in maintaining a sustained cell cycle. Therefore, understanding the regulation of
Vitali Sikirzhytski et al.
The Journal of cell biology, 217(8), 2647-2659 (2018-06-17)
For proper segregation during cell division, each chromosome must connect to the poles of the spindle via microtubule bundles termed kinetochore fibers (K-fibers). K-fibers form by two distinct mechanisms: (1) capture of astral microtubules nucleated at the centrosome by the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico