Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU130641

Sigma-Aldrich

MISSION® esiRNA

targeting human SORT1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCCTGGGTTGGAGATAGCACTGGGGTCATTCTAGTCTTGACTACCTTCCATGTACCACTGGTAATTATGACTTTTGGACAGTCCAAGCTATATCGAAGTGAGGATTATGGGAAGAACTTTAAGGATATTACAGATCTCATCAATAACACCTTTATTCGGACTGAATTTGGCATGGCTATTGGTCCTGAGAACTCTGGAAAGGTGGTGTTAACAGCAGAGGTGTCTGGAGGAAGTCGTGGAGGAAGAATCTTTAGATCATCAGATTTTGCGAAGAATTTTGTGCAAACAGATCTCCCTTTTCATCCTCTCACTCAGATGATGTATAGCCCTCAGAATTCTGATTATCTTTTAGCTCTCAGCACTGAAAATGGCCTGTGGGTGTCCAAGAATTTTGGGGGAAAATGGGAAGAAATCCACAAAGCAGTATGTTTGGCCAAATGGGGATCAGACAACACCATCTTCTTTACAACCTATGCAAATGGCTCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuncheng Lv et al.
Acta biochimica et biophysica Sinica, 51(5), 471-483 (2019-04-06)
Sortilin is closely associated with hyperlipidemia and the risk of atherosclerosis (AS). The role of sortilin and the underlying mechanism in peripheral macrophage are not fully understood. In this study, we investigated the effect of macrophage sortilin on ATP-binding cassette
Hye Youn Sung et al.
Journal of stroke, 20(3), 350-361 (2018-10-13)
The pathogenesis of moyamoya disease (MMD) remains poorly understood, and no reliable molecular biomarkers for MMD have been identified to date. The present study aimed to identify epigenetic biomarkers for use in the diagnosis of MMD. We performed integrated analyses
Keiji Uchiyama et al.
PLoS pathogens, 13(6), e1006470-e1006470 (2017-07-01)
Prion diseases are a group of fatal neurodegenerative disorders caused by prions, which consist mainly of the abnormally folded isoform of prion protein, PrPSc. A pivotal pathogenic event in prion disease is progressive accumulation of prions, or PrPSc, in brains
Swati Venkat et al.
Molecular biology of the cell, 28(19), 2569-2578 (2017-08-05)
Elevated, nontoxic doses of manganese (Mn) protect against Shiga toxin-1-induced cell death via down-regulation of GPP130, a cycling Golgi membrane protein that serves as an endosome-to-Golgi trafficking receptor for the toxin. Mn binds to GPP130 in the Golgi and causes
Fangfang Gao et al.
The American journal of pathology, 190(9), 1931-1942 (2020-06-12)
Pancreatic cancer has a dismal prognosis, and there is no targeted therapy against this malignancy. The neuronal membrane protein sortilin is emerging as a regulator of cancer cell development, but its expression and impact in pancreatic cancer are unknown. This

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico