Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU120451

Sigma-Aldrich

MISSION® esiRNA

targeting human RAPGEF3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTCTTTGAACCACACAGCAAGGCAGGGACCGTGTTGTTCAGCCAGGGGGACAAGGGCACTTCGTGGTACATTATCTGGAAGGGATCTGTCAACGTGGTGACCCATGGCAAGGGGCTGGTGACCACCCTGCATGAGGGAGATGATTTTGGACAGCTGGCTCTGGTGAATGATGCACCCCGGGCAGCCACCATCATCCTGCGAGAAGACAACTGTCATTTCCTGCGTGTGGACAAGCAGGACTTCAACCGTATCATCAAGGATGTGGAGGCAAAGACCATGCGGCTGGAAGAACATGGCAAAGTGGTGCTGGTGCTGGAGAGAGCCTCTCAGGGCGCCGGCCCTTCCCGACCCCCAACCCCAGGCAGGAACCGGTATACAGTGATGTCTGGCACCCCAGAGAAGATCCTAGAGCTTCTGTTGGAGGCCATGGGACCAGATTCCAGTGCTCATGACCCAACAGAGACATTCCTCAGCGACTTCCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Li Liu et al.
Molecular vision, 23, 1-7 (2017-02-18)
Increased inflammatory mediator levels are reported in diabetic retinopathy. We previously reported that β-adrenergic receptor agonists reduced inflammatory mediators in the diabetic retina; however, these agents cannot be given systemically. Here, we investigated whether Epac1 is key to the protective
Jolanta Wiejak et al.
Biochimica et biophysica acta. Molecular cell research, 1866(2), 264-276 (2018-11-12)
Exchange protein activated by cyclic AMP (EPAC1) suppresses multiple inflammatory actions in vascular endothelial cells (VECs), partly due to its ability to induce expression of the suppressor of cytokine signalling 3 (SOCS3) gene, the protein product of which inhibits interleukin
Kazuya Kusama et al.
Reproduction, fertility, and development (2018-05-08)
Protein kinase A (PKA) signalling accompanies elevated intracellular cAMP levels during endometrial stromal cell (ESC) decidualisation. Exchange protein directly activated by cAMP (EPAC), an alternate mediator of cAMP signalling, promotes PKA analogue-induced decidualisation; however, the precise mechanism by which EPAC
Jaspal Garg et al.
Oncotarget, 8(27), 44732-44748 (2017-05-18)
Chronic stress has been associated with the progression of cancer and antagonists for β-adrenoceptors (βAR) are regarded as therapeutic option. As they are also used to treat hemangiomas as well as retinopathy of prematurity, a role of endothelial β2AR in
Jongbo Lee et al.
PLoS biology, 18(12), e3001002-e3001002 (2020-12-29)
Nucleocytoplasmic transport (NCT) defects have been implicated in neurodegenerative diseases such as C9ORF72-associated amyotrophic lateral sclerosis and frontotemporal dementia (C9-ALS/FTD). Here, we identify a neuroprotective pathway of like-Sm protein 12 (LSM12) and exchange protein directly activated by cyclic AMP 1

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico