Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU117241

Sigma-Aldrich

MISSION® esiRNA

targeting human CDC42

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACACA

Ensembl | human accession no.

ENSG00000070831

NCBI accession no.

NM_001791

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CDC42(998) , CDC42(998)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaolei Liu et al.
Development (Cambridge, England), 145(17) (2018-07-26)
Although major progress in our understanding of the genes and mechanisms that regulate lymphatic vasculature development has been made, we still do not know how lumen formation and maintenance occurs. Here, we identify the Ras-interacting protein Rasip1 as a key
Arjun P Athreya et al.
Oncotarget, 8(16), 27199-27215 (2017-04-21)
We demonstrate that model-based unsupervised learning can uniquely discriminate single-cell subpopulations by their gene expression distributions, which in turn allow us to identify specific genes for focused functional studies. This method was applied to MDA-MB-231 breast cancer cells treated with
Shayoni Ray et al.
Molecular biology of the cell, 25(16), 2393-2407 (2014-06-27)
Coordinated actin microfilament and microtubule dynamics is required for salivary gland development, although the mechanisms by which they contribute to branching morphogenesis are not defined. Because LIM kinase (LIMK) regulates both actin and microtubule organization, we investigated the role of
Tilman D Rachner et al.
Breast cancer research : BCR, 16(1), R20-R20 (2014-02-18)
Amino-bisphosphonates and statins inhibit the mevalonate pathway, and may exert anti-tumor effects. The Wnt inhibitor dickkopf-1 (DKK-1) promotes osteolytic bone lesions by inhibiting osteoblast functions and has been implicated as an adverse marker in multiple cancers. We assessed the effects

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico