Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU111271

Sigma-Aldrich

MISSION® esiRNA

targeting human HNRNPA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAGCCCTGTCAAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAAAGAGGTCGAAGTGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGGTGGTTTCGGTGGGAATGACAACTTCGGTCGTGGAGGAAACTTCAGTGGTCGTGGTGGCTTTGGTGGCAGCCGTGGTGGTGGTGGATATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGTGGTTATGGAGGAGGCGGCCCTGGTTACTCTGGAGGAAGCAGAGGCTATGGAAGTGGTGGACAGGGTTATGGAAACCAGGGCAGTGGCTATGGCGGGAGTGGCAGCTATGACAGCTATAACAACGGAGGCGGAGGCGGCTTTGGCGGTGGTAGTGGTAGCAATTTTGGAGGTGGTGGAAGCTAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Cheng-Kai Chang et al.
PloS one, 12(11), e0188214-e0188214 (2017-11-18)
The viral ribonucleoprotein (vRNP) of influenza A virus is formed by virion RNA (vRNA), viral polymerase complex, and nucleoprotein (NP). The NP plays an important role in facilitating the replication and stabilization of viral RNA. To explore host factors that
Mariana D Mandler et al.
Nucleic acids research, 42(11), 7319-7329 (2014-05-06)
The selective RNA-binding protein quaking I (QKI) plays important roles in controlling alternative splicing (AS). Three QKI isoforms are broadly expressed, which display distinct nuclear-cytoplasmic distribution. However, molecular mechanisms by which QKI isoforms control AS, especially in distinct cell types
Mei-Ling Li et al.
Methods (San Diego, Calif.), 183, 13-20 (2020-02-23)
Enterovirus A71 (EV-A711) RNA contains an internal ribosomal entry site (IRES) to direct cap-independent translation. IRES-dependent translation requires the host's translation initiation factors and IRES-associated trans-acting factors (ITAFs). We previously showed that hnRNP A1, the mRNA stability factor HuR, and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico