Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU108601

Sigma-Aldrich

MISSION® esiRNA

targeting human RBM4, RBM14-RBM4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGATTCGCTCACTCTTCGAGCAGTATGGGAAGGTGCTGGAATGTGACATCATTAAGAATTACGGCTTTGTGCACATAGAAGACAAGACGGCAGCTGAGGATGCCATACGCAACCTGCACCATTACAAGCTTCATGGGGTGAACATCAACGTGGAAGCCAGCAAGAATAAGAGCAAAACCTCAACAAAGTTGCATGTGGGCAACATCAGTCCCACCTGCACCAATAAGGAGCTTCGAGCCAAGTTTGAGGAGTATGGTCCGGTCATCGAATGTGACATCGTGAAAGATTATGCCTTCGTACACATGGAGCGGGCAGAGGATGCAGTGGAGGCCATCAGGGGCCTTGATAACACAGAGTTTCAAGGCAAACGAATGCACGTGCAGTTGTCCACCAGCCGGCTTAGGACTGCGCCCGGGATGGGAGACCAGAGCGGCTGCTATCGGTGCGGGAAAGAGGGGCACTGGTCCAAAGAGTGTCCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Guo-Wei Huang et al.
The international journal of biochemistry & cell biology, 90, 59-67 (2017-07-30)
LncRNAs play a vital role in alternative splicing of target genes. However, the mechanisms underlying lncRNAs involvement in splicing are poorly understood. In the present study, we identified a previously uncharacterized lncRNA, which is denoted as TPM1-AS, is reverse-transcribed from
S Kagawa et al.
Oncogene, 34(18), 2347-2359 (2014-06-17)
Notch activity regulates tumor biology in a context-dependent and complex manner. Notch may act as an oncogene or a tumor-suppressor gene even within the same tumor type. Recently, Notch signaling has been implicated in cellular senescence. Yet, it remains unclear
Sven Hennig et al.
The Journal of cell biology, 210(4), 529-539 (2015-08-19)
Prion-like domains (PLDs) are low complexity sequences found in RNA binding proteins associated with the neurodegenerative disorder amyotrophic lateral sclerosis. Recently, PLDs have been implicated in mediating gene regulation via liquid-phase transitions that drive ribonucleoprotein granule assembly. In this paper

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico