Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU108041

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGTGTGGACACTGCTTCAGAAAGGGAGAAGCGTTAGTGCTGCCGACCTGAGCGAGGCCGAGCCACTCACCCACATGAGCATCACCCGTCTGCATGAGCAGAAGCTGGTGCAGCATGTGGTGTCTCAGAACTGTGACGGGCTCCACCTGAGGAGTGGGCTGCCGCGCACGGCCATCTCCGAGCTCCACGGGAACATGTACATTGAAGTCTGTACCTCCTGCGTTCCCAACAGGGAGTACGTGCGGGTGTTCGATGTGACGGAGCGCACTGCCCTCCACAGACACCAGACAGGCCGGACCTGCCACAAGTGTGGGACCCAGCTGCGGGACACCATTGTGCACTTTGGGGAGAGGGGGACGTTGGGGCAGCCTTTGAACTGGGAAGCGACCGAGGCTGCCAGCAGAGCAGACACCATCCT

Ensembl | human accession no.

ENSG00000187531

NCBI accession no.

NM_016538

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SIRT7(51547) , SIRT7(51547)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Romain Haider et al.
Oncotarget, 8(44), 77309-77316 (2017-11-05)
Predictive biomarkers for advanced prostate cancer (PCa) are still missing. The sirtuin 7 (SIRT7) has been linked to tumorogenesis but its role in prostate cancer is poorly documented. To determine if SIRT7 can be a biomarker for aggressive prostate cancer
Bin Jia et al.
IUBMB life, 73(1), 264-272 (2020-12-17)
Oral squamous cell carcinoma (OSCC) is a common malignant cancer with unfavorable prognosis, and the epithelial-to-mesenchymal transition (EMT) is a critical contributor to OSCC metastasis. Recently, we have shown that sirtuin 7 (Sirt7) is associated with EMT and OSCC metastasis
Anne E Wyman et al.
American journal of physiology. Lung cellular and molecular physiology, 312(6), L945-L958 (2017-04-08)
Pulmonary fibrosis is a severe condition with no cure and limited therapeutic options. A better understanding of its pathophysiology is needed. Recent studies have suggested that pulmonary fibrosis may be driven by accelerated aging-related mechanisms. Sirtuins (SIRTs), particularly SIRT1, SIRT3
Wang Wei et al.
American journal of cancer research, 7(9), 1788-1803 (2017-10-06)
It is still a controversy whether the role of Sirtuin 7 (SIRT7) is an oncogene or a tumor suppressor gene in cancer as SIRT7 may have different functions in different types of cancer. Particularly, the specific roles of SIRT7 in
Wenzhi Li et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 100, 257-266 (2018-02-14)
Accumulating evidence indicates that sirtuin7 (SIRT7) plays an oncogenic role in the main types of liver cancer, hepatocellular carcinoma (HCC). Nevertheless, the clinical significance of SIRT7 and its role in cholangiocarcinoma (CCA) is largely undiscovered. Here, we found that SIRT7
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico