Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU106951

Sigma-Aldrich

MISSION® esiRNA

targeting human AKR1B1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGACCTGAAGCTGGACTACCTGGACCTCTACCTTATTCACTGGCCGACTGGCTTTAAGCCTGGGAAGGAATTTTTCCCATTGGATGAGTCGGGCAATGTGGTTCCCAGTGACACCAACATTCTGGACACGTGGGCGGCCATGGAAGAGCTGGTGGATGAAGGGCTGGTGAAAGCTATTGGCATCTCCAACTTCAACCATCTCCAGGTGGAGATGATCTTAAACAAACCTGGCTTGAAGTATAAGCCTGCAGTTAACCAGATTGAGTGCCACCCATATCTCACTCAGGAGAAGTTAATCCAGTACTGCCAGTCCAAAGGCATCGTGGTGACCGCCTACAGCCCCCTCGGCTCTCCTGACAGGCCCTGGGCCAAGCCCGAGGACCCTTCTCTCCTGGAGGATCCCAGGATCAAGGCGATCGCAGCCAAGCACAATAAAACTACAGCCCAGGTCCTGATCCGGTTCCCCATGCAGAGGAACTTGGTGGTGATCCCCAAGTCTGTGACA

Ensembl | human accession no.

ENSG00000085662

NCBI accession no.

NM_001628

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AKR1B1(231) , AKR1B1(231)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xuebiao Wu et al.
The Journal of experimental medicine, 214(4), 1065-1079 (2017-03-09)
Basal-like breast cancer (BLBC) is associated with high-grade, distant metastasis and poor prognosis. Elucidating the determinants of aggressiveness in BLBC may facilitate the development of novel interventions for this challenging disease. In this study, we show that aldo-keto reductase 1
Boel De Paepe et al.
Frontiers in neurology, 9, 846-846 (2018-10-27)
We recently identified osmolyte accumulators as novel biomarkers for chronic skeletal muscle inflammation and weakness, but their precise involvement in inflammatory myopathies remains elusive. In the current study, we demonstrate in vitro that, in myoblasts and myotubes exposed to pro-inflammatory
Pabitra B Pal et al.
Endocrinology, 158(10), 3661-3675 (2017-09-25)
Despite recent studies that show oxidative stress-generated reactive oxygen species (ROS) regulate NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome-mediated innate immune response in various diabetic complications, the mechanism by which ROS activate innate immune response is not well
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico