Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU106111

Sigma-Aldrich

MISSION® esiRNA

targeting human KRT17

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCACCAAGTTTGAGACAGAGCAGGCCCTGCGCCTGAGTGTGGAGGCCGACATCAATGGCCTGCGCAGGGTGCTGGATGAGCTGACCCTGGCCAGAGCCGACCTGGAGATGCAGATTGAGAACCTCAAGGAGGAGCTGGCCTACCTGAAGAAGAACCACGAGGAGGAGATGAACGCCCTGCGAGGCCAGGTGGGTGGTGAGATCAATGTGGAGATGGACGCTGCCCCAGGCGTGGACCTGAGCCGCATCCTCAACGAGATGCGTGACCAGTATGAGAAGATGGCAGAGAAGAACCGCAAGGATGCCGAGGATTGGTTCTTCAGCAAGACAGAGGAACTGAACCGCGAGGTGGCCACCAACAGTGAGCTGGTGCAGAGTGGCAAGAGTGAGATCTCGGAGCTCCGGCGCACCATGCAGGCCTTGGAGATAGA

Ensembl | human accession no.

ENSG00000186831

NCBI accession no.

NM_000422

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KRT17(3872) , KRT17(3872)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chun-Ying Xiao et al.
Chinese medical journal, 133(24), 2910-2918 (2020-11-26)
Psoriasis is a common chronic inflammatory skin disease with 2% to 3% prevalence worldwide and a heavy social-psychological burden for patients and their families. As the exact pathogenesis of psoriasis is still unknown, the current treatment is far from satisfactory.
Mihaela Chivu-Economescu et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 20(6), 948-959 (2017-03-17)
Keratin 17 (KRT17) was shown to be an important molecular marker for predicting the carcinogenesis, progression, and prognosis of various cancer types. Our previous studies identified KRT17 as a possible biomarker for gastric cancer by gene microarray, with an elevated
Hui Liu et al.
Gene, 563(1), 35-40 (2015-03-10)
Hereditary protein C deficiency (PCD) is an autosomal inherited disorder associated with high risk for venous thromboembolism (VTE). This study aimed to explore the functional consequences of two missense mutations, p.Asp297His and p.Val420Ile, responsible for type I/II PCD and recurrent
Jason D Arroyo et al.
Nucleic acids research, 42(9), 6064-6077 (2014-03-07)
Unlike short interfering RNAs (siRNAs), which are commonly designed to repress a single messenger RNA (mRNA) target through perfect base pairing, microRNAs (miRNAs) are endogenous small RNAs that have evolved to concurrently repress multiple mRNA targets through imperfect complementarity. MicroRNA

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico