Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU105981

Sigma-Aldrich

MISSION® esiRNA

targeting human BMPR1A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCAAGAGCATCTCAAGCAGACGTCGTTACAATCGTGATTTGGAACAGGATGAAGCATTTATTCCAGTTGGAGAATCACTAAAAGACCTTATTGACCAGTCACAAAGTTCTGGTAGTGGGTCTGGACTACCTTTATTGGTTCAGCGAACTATTGCCAAACAGATTCAGATGGTCCGGCAAGTTGGTAAAGGCCGATATGGAGAAGTATGGATGGGCAAATGGCGTGGCGAAAAAGTGGCGGTGAAAGTATTCTTTACCACTGAAGAAGCCAGCTGGTTTCGAGAAACAGAAATCTACCAAACTGTGCTAATGCGCCATGAAAACATACTTGGTTTCATAGCGGCAGACATTAAAGGTACAGGTTCCTGGACTCAGCTCTATTTGATTACTGATTACCATGAAAATGGATCTCTCTATGACTTCCTGAAATGTGCTACACTGGACACCAGAGCCCTGCTTAAATTGGCTTATTCAGCTGCCTGTGGTCTGTGCCACCTGCACACAGAAATTTATGGCACCCAAGGAAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wencai Shi et al.
Biological trace element research, 176(2), 294-304 (2016-09-24)
Hepcidin synthesis is reported to be inadequate according to the body iron store in patients with non-alcoholic fatty liver disease (NAFLD) undergoing hepatic iron overload (HIO). However, the underlying mechanisms remain unclear. We hypothesize that hepatocyte nuclear factor-4α (HNF-4α) may
Zhixian Yu et al.
PloS one, 11(12), e0168334-e0168334 (2016-12-16)
Approximately 30% of tumor endothelial cells have over-duplicated (>2) centrosomes, which may contribute to abnormal vessel function and drug resistance. Elevated levels of vascular endothelial growth factor A induce excess centrosomes in endothelial cells, but how other features of the
Mian Guo et al.
Carcinogenesis, 35(8), 1698-1706 (2014-02-01)
Bone morphogenetic protein-2 (BMP-2), a member of the transforming growth factor-β family, plays critical roles in cell differentiation, modeling and regeneration processes in several tissues. BMP-2 is also closely associated with various malignant tumors. microRNAs negatively and posttranscriptionally regulate gene

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico