Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU099041

Sigma-Aldrich

MISSION® esiRNA

targeting human CBS

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGAC

Ensembl | human accession no.

ENSG00000160200

NCBI accession no.

NM_000071

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CBS(102724560) , CBS(875)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Huina Jia et al.
Oncology reports, 37(5), 3001-3009 (2017-04-26)
Hydrogen sulfide (H2S), the third gasotransmitter, plays important roles in cancer biological processes. As endogenous H2S exerts pro-cancer functions, inhibition of its production in cancer cells may provide a new cancer treatment strategy and be achieved via regulation of the function
Liam J O'Connor et al.
ACS central science, 3(1), 20-30 (2017-02-06)
Azide-containing compounds have broad utility in organic synthesis and chemical biology. Their use as powerful tools for the labeling of biological systems
Xingji You et al.
Reproduction (Cambridge, England), 153(5), 535-543 (2017-02-12)
Recent evidence suggests that uterine activation for labor is associated with inflammation within uterine tissues. Hydrogen sulfide (H
Nozomu Takahashi et al.
Nucleic acids research, 45(1), 435-445 (2016-08-29)
The 2-methylthio (ms
Xiangning Yuan et al.
Kidney & blood pressure research, 42(3), 428-443 (2017-07-28)
Renal tubulointerstitial fibrosis (TIF) is the common pathway of progressive chronic kidney disease. Inflammation has been widely accepted as the major driving force of TIF. Cystathionine β-synthase (CBS) is the first and rate-limiting enzyme in the transsulfuration pathway. CBS is
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico