Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU093621

Sigma-Aldrich

MISSION® esiRNA

targeting human IQGAP3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGGCGTCTGCACTACTTCCAGAAGAATGTTAACTCCATTGTGAAGATCCAGGCATTTTTCCGAGCCAGGAAAGCCCAAGATGACTACAGGATATTAGTGCATGCACCCCACCCTCCTCTCAGTGTGGTACGCAGATTTGCCCATCTCTTGAATCAAAGCCAGCAAGACTTCTTGGCTGAGGCAGAGCTGCTGAAGCTCCAGGAAGAGGTAGTTAGGAAGATCCGATCCAATCAGCAGCTGGAGCAGGACCTCAACATCATGGACATCAAGATTGGCCTGCTGGTGAAGAACCGGATCACTCTGCAGGAAGTGGTCTCCCACTGCAAGAAGCTGACCAAGAGGAATAAGGAACAGCTGTCAGATATGATGGTTCTGGACAAGCAGAAGGGTTTAAAGTCGCTGAGCAAAGAGAAACGGCAGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yongjie Shi et al.
Journal of translational medicine, 15(1), 176-176 (2017-08-16)
Hepatocellular carcinoma (HCC) is one of the most lethal cancers worldwide owing to its high rates of metastasis and recurrence. The oncogene IQ motif-containing GTPase activating protein 3 (IQGAP3) is ubiquitously overexpressed in several human cancers, including liver, ovary, lung
Naohide Oue et al.
Pathobiology : journal of immunopathology, molecular and cellular biology, 85(3), 192-200 (2017-11-14)
Spheroid colony formation is a useful method of cancer stem cell (CSC) characterization. We previously showed that the IQ motif containing the GTPase-activating protein 3 gene (IQGAP3) is upregulated in spheroid body-forming gastric cancer (GC) cells compared with parental cells.
Chase J Morgan et al.
Scientific reports, 9(1), 11057-11057 (2019-08-01)
The Ras family of small GTPases modulates numerous essential processes. Activating Ras mutations result in hyper-activation of selected signaling cascades, which leads to human diseases. The high frequency of Ras mutations in human malignant neoplasms has led to Ras being

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico