Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU086071

Sigma-Aldrich

MISSION® esiRNA

targeting human FAP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGTCCCTGCAGTCAGAGTGTAAGGTCTGTATTTGCTGTTAATTGGATATCTTATCTTGCAAGTAAGGAAGGGATGGTCATTGCCTTGGTGGATGGTCGAGGAACAGCTTTCCAAGGTGACAAACTCCTCTATGCAGTGTATCGAAAGCTGGGTGTTTATGAAGTTGAAGACCAGATTACAGCTGTCAGAAAATTCATAGAAATGGGTTTCATTGATGAAAAAAGAATAGCCATATGGGGCTGGTCCTATGGAGGATACGTTTCATCACTGGCCCTTGCATCTGGAACTGGTCTTTTCAAATGTGGTATAGCAGTGGCTCCAGTCTCCAGCTGGGAATATTACGCGTCTGTCTACACAGAGAGATTCATGGGTCTCCCAACAAAGGATGATAATCTTGAGCACTATAAGAATTCAACTGTGATGGCAAGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuli Lin et al.
Neoplasia (New York, N.Y.), 21(12), 1133-1142 (2019-11-24)
Desmoplasia is a hallmark of intrahepatic cholangiocarcinoma (ICC), which constitutes a barrier to infiltration of lymphocyte, but not myeloid cells. Given that dense desmoplastic stroma has been reported to be a barrier to infiltration of lymphocyte, but not myeloid cells.
Dimitrios Patsouras et al.
Molecular medicine reports, 11(6), 4585-4590 (2015-01-28)
Fibroblast activation protein (FAP), a selective protein for tumor stromal fibroblasts, is expressed in >90% of human epithelial carcinomas. A characteristic feature of pancreatic cancer is an extensive fibrotic or desmoplastic reaction surrounding the primary tumor. The present study aimed
Jochen Tillmanns et al.
Journal of molecular and cellular cardiology, 87, 194-203 (2015-09-01)
Fibroblast activation protein α (FAP) is a membrane-bound serine protease expressed by activated fibroblasts during wound healing in the skin. Expression of FAP after myocardial infarction (MI) and potential effects on cardiac wound healing are largely unknown. MI was induced

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico