Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU084801

Sigma-Aldrich

MISSION® esiRNA

targeting human ETS1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAGACCTTCCAAGGACAGCCGTGTTGGTTGGACTCTGAATTTTGAATTGTTATTCTATTTTTTATTTTCCAGAACTCATTTTTTACCTTCAGGGGTGGGAGCTAAGTCAGTTGCAGCTGTAATCAATTGTGCGCAGTTGGGAAAGGAAAGCCAGGACTTGTGGGGTGGGTGGGACCAGAAATTCTTGAGCAAATTTTCAGGAGAGGGAGAAGGGCCTTCTCAGAAGCTTGAAGGCTCTGGCTTAACAGAGAAAGAGACTAATGTGTCCAATCATTTTTAAAAATCATCCATGAAAAAGTGTCTTGAGTTGTGGACCCATTAGCAAGTGACATTGTCACATCAGAACTCATGAAACTGATGTAAGGCAATTAATTTGCTTCTGTTTTTAGGTCTGGGAGGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Huijie Gao et al.
Cancer letters, 354(2), 427-437 (2014-08-20)
We previously reported that β6 integrin played an important role in the progression of colon cancer. In this study, we demonstrated that β6 integrin induced the expression of MMP-3/MMP-9 and the invasion of colon cancer cells. Moreover, that function was
Haihong Liao et al.
Oncology reports, 40(4), 2389-2398 (2018-08-15)
An increasing number of studies have reported that microRNAs (miRNAs) are dysregulated in cervical cancer and serve critical roles in cervical oncogenesis and progression. Therefore, identifying the aberrantly expressed miRNAs implicated in the formation and progression of cervical cancer may
L Zhang et al.
European review for medical and pharmacological sciences, 23(5), 1986-1995 (2019-03-28)
MicroRNA-338-3p (miR-338-3p) was reported to influence the metastasis and development of several human cancers. However, in bladder cancer (BC), the special function of miR-338-3p remains unknown. Here, we aimed at exploring the miR-338-3p function in the progression of BC. miR-338-3p
X Zhao et al.
European review for medical and pharmacological sciences, 24(1), 181-188 (2020-01-21)
This study aims to detect microRNA-326 expression in nasopharyngeal carcinoma (NPC) tissues and cell lines and to explore the potential mechanism of microRNA-326 inhibiting the proliferative capacity and invasiveness of NPC cells. Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) was performed
Yutao Yang et al.
Molecular neurobiology, 54(6), 4421-4431 (2016-06-29)
Galanin receptor 2 (GAL2R) is a G protein-coupled receptor for the neuropeptide galanin that regulates many important physiological functions and pathological processes. To investigate the molecular mechanism governing GAL2R gene transcription, the rat GAL2R promoter was isolated and analyzed. We

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico