Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU080821

Sigma-Aldrich

MISSION® esiRNA

targeting human RHOT1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCTGGAATATTTGGGCTATCTAGGCTATTCAATATTGACTGAGCAAGAGTCTCAAGCTTCAGCTGTTACAGTGACAAGAGATAAAAAGATAGACCTGCAGAAAAAACAAACTCAAAGAAATGTGTTCAGATGTAATGTAATTGGAGTGAAAAACTGTGGGAAAAGTGGAGTTCTTCAGGCTCTTCTTGGAAGAAACTTAATGAGGCAGAAGAAAATTCGTGAAGATCATAAATCCTACTATGCGATTAACACTGTTTATGTATATGGACAAGAGAAATACTTGTTGTTGCATGATATCTCAGAATCGGAATTTCTAACTGAAGCTGAAATCATTTGTGATGTTGTATGCCTGGTATATGATGTCAGCAATCCCAAATCCTTTGAATACTGTGCCAGGATTTTTAAGCAACACTTTATGGACAGCAGAATACCTTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ekta Agarwal et al.
Molecular and cellular biology, 39(14) (2019-05-08)
The Myc gene is a universal oncogene that promotes aggressive cancer, but its role in metastasis has remained elusive. Here, we show that Myc transcriptionally controls a gene network of subcellular mitochondrial trafficking that includes the atypical mitochondrial GTPases RHOT1
Tanveer Ahmad et al.
The EMBO journal, 33(9), 994-1010 (2014-01-17)
There is emerging evidence that stem cells can rejuvenate damaged cells by mitochondrial transfer. Earlier studies show that epithelial mitochondrial dysfunction is critical in asthma pathogenesis. Here we show for the first time that Miro1, a mitochondrial Rho-GTPase, regulates intercellular

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico